ID: 1161286370

View in Genome Browser
Species Human (GRCh38)
Location 19:3470486-3470508
Sequence AACAACAAGTAGAAGTGGCC GGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1161286367_1161286370 -3 Left 1161286367 19:3470466-3470488 CCAGGTCAGGAAGAACAGTGAAC No data
Right 1161286370 19:3470486-3470508 AACAACAAGTAGAAGTGGCCGGG No data
1161286361_1161286370 22 Left 1161286361 19:3470441-3470463 CCCGTCTTGGAGCCTACAGCTTC No data
Right 1161286370 19:3470486-3470508 AACAACAAGTAGAAGTGGCCGGG No data
1161286362_1161286370 21 Left 1161286362 19:3470442-3470464 CCGTCTTGGAGCCTACAGCTTCC No data
Right 1161286370 19:3470486-3470508 AACAACAAGTAGAAGTGGCCGGG No data
1161286366_1161286370 0 Left 1161286366 19:3470463-3470485 CCTCCAGGTCAGGAAGAACAGTG No data
Right 1161286370 19:3470486-3470508 AACAACAAGTAGAAGTGGCCGGG No data
1161286364_1161286370 10 Left 1161286364 19:3470453-3470475 CCTACAGCTTCCTCCAGGTCAGG No data
Right 1161286370 19:3470486-3470508 AACAACAAGTAGAAGTGGCCGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1161286370 Original CRISPR AACAACAAGTAGAAGTGGCC GGG Intergenic
No off target data available for this crispr