ID: 1161286451

View in Genome Browser
Species Human (GRCh38)
Location 19:3471004-3471026
Sequence CAGAGTGAGGAGAGGGATGG AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1161286446_1161286451 -8 Left 1161286446 19:3470989-3471011 CCTGTGTGGCTGGAGCAGAGTGA 0: 38
1: 109
2: 326
3: 700
4: 1386
Right 1161286451 19:3471004-3471026 CAGAGTGAGGAGAGGGATGGAGG No data
1161286441_1161286451 21 Left 1161286441 19:3470960-3470982 CCTGCTTCATTGGAGGAACAGTG No data
Right 1161286451 19:3471004-3471026 CAGAGTGAGGAGAGGGATGGAGG No data
1161286440_1161286451 26 Left 1161286440 19:3470955-3470977 CCATGCCTGCTTCATTGGAGGAA No data
Right 1161286451 19:3471004-3471026 CAGAGTGAGGAGAGGGATGGAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1161286451 Original CRISPR CAGAGTGAGGAGAGGGATGG AGG Intergenic
No off target data available for this crispr