ID: 1161289402 |
View in Genome Browser |
Species | Human (GRCh38) |
Location | 19:3485007-3485029 |
Sequence | CAGAGTGAGCCGGGGGAGTG GGG |
Strand | + |
Crispr in exon? | No |
Crispr in intron? | No |
Off-Target Counts | All | Exonic | Intronic | Intergenic |
---|---|---|---|---|
Total | No data | |||
Summary | No data |
Found 2 Related Crispr Pairs
Show Crispr PairsID | Spacer | Status | Summary | ID | Location | Sequence | Summary | |
---|---|---|---|---|---|---|---|---|
1161289395_1161289402 | -8 | Left | 1161289395 | 19:3484992-3485014 | CCAGTGTGGCTGGAGCAGAGTGA | 0: 38 1: 109 2: 326 3: 700 4: 1386 |
||
Right | 1161289402 | 19:3485007-3485029 | CAGAGTGAGCCGGGGGAGTGGGG | No data | ||||
1161289390_1161289402 | 21 | Left | 1161289390 | 19:3484963-3484985 | CCTGGCGTGTTGGAGGAACAGTG | No data | ||
Right | 1161289402 | 19:3485007-3485029 | CAGAGTGAGCCGGGGGAGTGGGG | No data |
Note: the row highlighted in blue is the original CRISPR
WGE ID | Location | Sequence | Mismatches | Strand | Type |
---|---|---|---|---|---|
1161289402 | Original CRISPR | CAGAGTGAGCCGGGGGAGTG GGG | Intergenic | ||
No off target data available for this crispr |