ID: 1161289402

View in Genome Browser
Species Human (GRCh38)
Location 19:3485007-3485029
Sequence CAGAGTGAGCCGGGGGAGTG GGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1161289395_1161289402 -8 Left 1161289395 19:3484992-3485014 CCAGTGTGGCTGGAGCAGAGTGA 0: 38
1: 109
2: 326
3: 700
4: 1386
Right 1161289402 19:3485007-3485029 CAGAGTGAGCCGGGGGAGTGGGG No data
1161289390_1161289402 21 Left 1161289390 19:3484963-3484985 CCTGGCGTGTTGGAGGAACAGTG No data
Right 1161289402 19:3485007-3485029 CAGAGTGAGCCGGGGGAGTGGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1161289402 Original CRISPR CAGAGTGAGCCGGGGGAGTG GGG Intergenic
No off target data available for this crispr