ID: 1161293330

View in Genome Browser
Species Human (GRCh38)
Location 19:3507074-3507096
Sequence CAACCCGTGCCTGCGGGGAC TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 74
Summary {0: 1, 1: 0, 2: 0, 3: 5, 4: 68}

Found 0 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1161293330 Original CRISPR CAACCCGTGCCTGCGGGGAC TGG (reversed) Intronic
900284165 1:1891279-1891301 CGGCCCGGCCCTGCGGGGACCGG + Intergenic
900506460 1:3031935-3031957 CAACCCGGGCCAGCGAGGATGGG + Intergenic
901926189 1:12567687-12567709 CAACCCATGGCTGCTGGGAGGGG + Intergenic
902057922 1:13617852-13617874 GACCCAGTGCCTGCGGGGACAGG + Exonic
908738987 1:67307921-67307943 GGTCCCGGGCCTGCGGGGACCGG - Exonic
912859209 1:113198117-113198139 CAACTTCTGCCTGAGGGGACAGG - Intergenic
1064482015 10:15749259-15749281 CAGCCCGTCCCTGTGGGTACAGG + Intergenic
1066381487 10:34905702-34905724 AACCCCGTGCCTGAGGGGTCAGG - Intergenic
1074477338 10:113784926-113784948 CAACCAGTGCCTGGAGGAACTGG + Intergenic
1075383738 10:122039548-122039570 CAACAAGTGCCTGGGAGGACTGG + Intronic
1075649625 10:124119196-124119218 CCACCTGTGCCTGAAGGGACGGG + Intergenic
1078269308 11:9780274-9780296 CAACCCCTGCAAGAGGGGACTGG + Exonic
1078442330 11:11378252-11378274 CAACCTGTGCCCCCGGGGAGTGG - Intronic
1081730673 11:45369753-45369775 CGACCCGAGCCTGAGGGGGCAGG - Intergenic
1083234693 11:61343980-61344002 CAACCCCTGCCTTTGGGGAAGGG + Intronic
1084308558 11:68302424-68302446 CCACCCATGCTTGCGGGGAGGGG + Intergenic
1091427182 12:401394-401416 CAACCCGCTCCTCCAGGGACGGG - Intronic
1091546799 12:1506593-1506615 TAACCCCTGCCTGCAGGGTCTGG + Intergenic
1100455054 12:94743429-94743451 CAAACCATGCCTGTGGGTACAGG - Intergenic
1101389632 12:104288822-104288844 CACGCGGTGCCTGCGGGGCCGGG + Intronic
1113656969 13:112073252-112073274 CGCCCCGAGGCTGCGGGGACGGG - Intergenic
1121576837 14:94995712-94995734 CAACTGGACCCTGCGGGGACAGG + Intergenic
1121838030 14:97109372-97109394 CATCCCATTCTTGCGGGGACTGG - Intergenic
1122931347 14:104934064-104934086 CGACCCGGGGCTGAGGGGACGGG + Exonic
1124323580 15:28737644-28737666 CAACCGGTGCCTCTGGGGATCGG - Intronic
1130221136 15:82020570-82020592 CAAGCTGTGCCTGAAGGGACAGG - Intergenic
1131096079 15:89655153-89655175 CATCCCGGGCCTGCGTGGAGGGG - Intronic
1132674786 16:1117115-1117137 CATCCTGGGCCTGTGGGGACAGG - Intergenic
1135734720 16:24921522-24921544 CAAGCTGTGCCTGCGTAGACGGG - Intronic
1141698431 16:85631572-85631594 GACCCCCTGCCTGCTGGGACTGG + Intronic
1144515907 17:15917554-15917576 CCTCCAGTGCCTGCGGGGGCAGG - Intergenic
1151660434 17:75515651-75515673 CAACTCGTGCCCGCCCGGACCGG + Intergenic
1160559592 18:79747717-79747739 AAACCCGTGCCGGCGTGGCCAGG - Intronic
1160691029 19:460788-460810 CAACCCGAGCCGGCGGGCCCGGG - Exonic
1161293330 19:3507074-3507096 CAACCCGTGCCTGCGGGGACTGG - Intronic
1161703025 19:5805232-5805254 CATCCCGGGCCGGCGGGGGCTGG - Intergenic
1161780860 19:6290994-6291016 CAACCTGTGTCTCCAGGGACAGG - Intergenic
1162065660 19:8123829-8123851 CAGCCTGTGCCCGCGGGGGCTGG - Exonic
1163843859 19:19628011-19628033 CGGCACGTGCCTGCGGGGCCAGG - Intronic
1166660465 19:44643866-44643888 CACCCCGCGCCTGGCGGGACTGG + Exonic
1167697647 19:51024621-51024643 CAAGCCGTGGGTGCGGGGGCTGG - Exonic
926322319 2:11757616-11757638 CAACAGGTGCCTGGGGTGACTGG + Intronic
934657593 2:96124127-96124149 CAGCCCGTTCCTGCAGGGCCTGG - Exonic
941095643 2:161237773-161237795 CAACCCGGGGCTGAGGGGGCGGG - Intergenic
943163695 2:184288212-184288234 CAACCCCTGCCTGATAGGACAGG + Intergenic
1169041685 20:2500708-2500730 CAATCCCTGCCTGCTGGGAGAGG - Exonic
1172788862 20:37488471-37488493 CATCCTGTGACTGTGGGGACAGG + Intergenic
1176042248 20:63072008-63072030 CAGTCGGTGCCTGCGGGGTCGGG - Intergenic
1180151227 21:45949077-45949099 CAGGCCGTGCCTGCGGCGACCGG - Intergenic
1185272093 22:49934480-49934502 CACCCCAGGCCTGCGGGGTCTGG - Intergenic
1185331122 22:50252469-50252491 CAGCCAGTCCCTGGGGGGACGGG - Intronic
950096468 3:10333603-10333625 AAACCCCTGCCTGAGGGCACTGG - Intronic
954877222 3:53810063-53810085 CAACCCCTCCCTACCGGGACTGG + Exonic
954930370 3:54276097-54276119 CAACCCATCCCTGCAGGGAGGGG - Intronic
957948073 3:87089496-87089518 AAAGCCATGCCTGCGGGGAGAGG + Intergenic
968525940 4:1057211-1057233 CAACCCAGGCCAGCGGGGACGGG + Intronic
973983700 4:56328644-56328666 CAATCAGAGCCTGTGGGGACTGG + Intergenic
978328946 4:107590325-107590347 CCACCTGTGGCTGCTGGGACGGG + Intronic
998166776 5:139848688-139848710 CGACACGTACCTGCGGGGAGAGG + Exonic
998463369 5:142325182-142325204 TAACCCGTGATTGCTGGGACTGG + Intronic
1001597859 5:172909508-172909530 AGACCCGTGCCTGAGGGCACAGG + Intronic
1001773300 5:174311561-174311583 CAAGCTGGGCCTGGGGGGACAGG + Intergenic
1006950899 6:37820126-37820148 CAGCCCGGGCCTACGGGGAGGGG + Intronic
1007771325 6:44194584-44194606 CAACTCCTGCCTACGGGGGCTGG + Intergenic
1009465944 6:63969672-63969694 CAATCCATGTCTGTGGGGACTGG + Intronic
1019788915 7:2997633-2997655 CAACCAGGGGCTCCGGGGACAGG + Intronic
1029595613 7:101536089-101536111 CAACCTCTGCCTCCTGGGACAGG + Intronic
1038228581 8:25679829-25679851 CAGCCCATGCCTGCGGGGAGGGG - Intergenic
1039786645 8:40840179-40840201 CAAGCCGTTCCTGAAGGGACAGG - Intronic
1052851369 9:33380423-33380445 CAACCAGTCCATGCTGGGACTGG + Intergenic
1057560992 9:96127648-96127670 CAGCAGGTGCCTGAGGGGACCGG + Intergenic
1062241109 9:135539293-135539315 CACCCTCTGCCTGCGTGGACCGG + Intergenic
1062521890 9:136961398-136961420 CCACCAGGGCCTGCAGGGACAGG + Intergenic
1195454327 X:105051269-105051291 CACCCCGAGCCTGCAGGGACTGG + Intronic