ID: 1161295633

View in Genome Browser
Species Human (GRCh38)
Location 19:3518934-3518956
Sequence TCCCACTACCTCCTCTGGTA GGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 170
Summary {0: 1, 1: 0, 2: 2, 3: 17, 4: 150}

Found 6 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1161295629_1161295633 -6 Left 1161295629 19:3518917-3518939 CCACCAGCTTGATTTTCTCCCAC 0: 1
1: 0
2: 0
3: 27
4: 341
Right 1161295633 19:3518934-3518956 TCCCACTACCTCCTCTGGTAGGG 0: 1
1: 0
2: 2
3: 17
4: 150
1161295626_1161295633 14 Left 1161295626 19:3518897-3518919 CCACCACCTGGAATGCTTCTCCA 0: 1
1: 2
2: 10
3: 61
4: 427
Right 1161295633 19:3518934-3518956 TCCCACTACCTCCTCTGGTAGGG 0: 1
1: 0
2: 2
3: 17
4: 150
1161295624_1161295633 28 Left 1161295624 19:3518883-3518905 CCTGGCAGCACATGCCACCACCT 0: 1
1: 0
2: 1
3: 30
4: 275
Right 1161295633 19:3518934-3518956 TCCCACTACCTCCTCTGGTAGGG 0: 1
1: 0
2: 2
3: 17
4: 150
1161295627_1161295633 11 Left 1161295627 19:3518900-3518922 CCACCTGGAATGCTTCTCCACCA 0: 1
1: 0
2: 3
3: 35
4: 252
Right 1161295633 19:3518934-3518956 TCCCACTACCTCCTCTGGTAGGG 0: 1
1: 0
2: 2
3: 17
4: 150
1161295628_1161295633 8 Left 1161295628 19:3518903-3518925 CCTGGAATGCTTCTCCACCAGCT 0: 1
1: 1
2: 4
3: 44
4: 340
Right 1161295633 19:3518934-3518956 TCCCACTACCTCCTCTGGTAGGG 0: 1
1: 0
2: 2
3: 17
4: 150
1161295630_1161295633 -9 Left 1161295630 19:3518920-3518942 CCAGCTTGATTTTCTCCCACTAC 0: 1
1: 0
2: 2
3: 14
4: 231
Right 1161295633 19:3518934-3518956 TCCCACTACCTCCTCTGGTAGGG 0: 1
1: 0
2: 2
3: 17
4: 150

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1161295633 Original CRISPR TCCCACTACCTCCTCTGGTA GGG Intronic
901766696 1:11504475-11504497 GCCCACTACCTGCTATGGTTTGG + Intronic
902183026 1:14704115-14704137 TCCCTCTACCTCCCCTGGGATGG + Intronic
902890238 1:19438072-19438094 TCCCACTACCTCCTACGTCAGGG + Intronic
903647120 1:24902366-24902388 TCCCCCTACCACCTCTACTACGG - Exonic
904108292 1:28104855-28104877 TCCCATTGCCTTCTTTGGTAGGG - Intergenic
909281543 1:73761229-73761251 TCCCACAACCTTCTCTTTTATGG + Intergenic
911935234 1:103961081-103961103 TCCCAGCACCTGCTCTGGTGTGG - Intergenic
913558735 1:119996935-119996957 ACCCACTACCTCCTGTGCTAGGG + Intronic
913639113 1:120793536-120793558 ACCCACTACCTCCTGTGCTAGGG - Intergenic
914279339 1:146156418-146156440 ACCCACTACCTCCTGTGCTAGGG + Intronic
914540383 1:148607348-148607370 ACCCACTACCTCCTGTGCTAGGG + Intronic
914626262 1:149463866-149463888 ACCCACTACCTCCTGTGCTAGGG - Intergenic
917783932 1:178432014-178432036 TCCCACAACCTCCTATAGAAAGG - Intronic
919974626 1:202602631-202602653 CCCAACTGCCTCCTCTGGGACGG - Intronic
920228693 1:204456038-204456060 TTCCACGACCTTCTCTGGGAAGG + Exonic
920987685 1:210906004-210906026 TCCCACTTCCTCTTCTGGCTTGG + Intronic
924425256 1:243944452-243944474 CCCCACTCCCTCCTCTGTTAGGG - Intergenic
1066008647 10:31171714-31171736 TTCCATTTCCTCCTCTTGTAAGG - Intergenic
1069922601 10:71825653-71825675 TCTCAGTACCTCCCCTGTTACGG - Intronic
1070667094 10:78352889-78352911 TCCCACTCCCTCCACTGCTTTGG + Intergenic
1070915767 10:80153649-80153671 TCCCAAGAACTCCTCTGCTAGGG - Exonic
1074218312 10:111409832-111409854 TCCTACTTCCTCCTATGCTATGG + Intergenic
1076762187 10:132611352-132611374 TCCCTCACCCTCCTCTGATAGGG - Intronic
1076762366 10:132611891-132611913 TCCCACACCCTCCTCTGATGGGG - Intronic
1076762384 10:132611936-132611958 TCCCACACCCTCCTCTGACAGGG - Intronic
1078097531 11:8309875-8309897 TCCCAATACCTACTCTGGCATGG + Intergenic
1080064791 11:27999002-27999024 TCCCCATACCTCCTCTTGTTTGG + Intergenic
1083316813 11:61820265-61820287 TCCCAGCACCTACTTTGGTAAGG + Intronic
1083355305 11:62061816-62061838 TCCCACTGCCTTCTCTGGGGAGG + Intergenic
1083649936 11:64196855-64196877 TCTCACCACCCCCTCTGCTATGG + Intronic
1084779570 11:71399517-71399539 TCCAACTTCCTCTTCTGATAAGG + Intergenic
1085312072 11:75522704-75522726 AGCCCCCACCTCCTCTGGTAGGG + Intronic
1087549117 11:99624491-99624513 ACCCACCACCTCATCTGATAAGG - Intronic
1089317268 11:117600586-117600608 TCCTCCTCCCTCCTCTGGTGGGG - Intronic
1092557852 12:9576886-9576908 TCCCATTACCTCATCTGAGATGG - Intergenic
1094343405 12:29439025-29439047 TCCCACTATCTCCACTAGGAGGG + Intronic
1094513441 12:31111024-31111046 TCCCAATACCTCATCTGAGATGG + Intergenic
1095810133 12:46365416-46365438 TCCCACTACTTGCTCTGGGAAGG + Intronic
1098142172 12:67461166-67461188 TACAACTACCTCCTCTGAGAGGG + Intergenic
1102254496 12:111407659-111407681 TCCCACTACCCCCTCTGGGAGGG + Intronic
1103141426 12:118552122-118552144 TCCCTCTCCTTCCTCTTGTAAGG + Intergenic
1104447095 12:128843445-128843467 TCCTTCTACCTCCTCTGCTATGG - Intergenic
1104447108 12:128843514-128843536 TCCTTCTACCTCCTCTGCTATGG - Intergenic
1108585477 13:51866579-51866601 TGCCTCTTCCTCCTCTGGTAGGG + Intergenic
1113978508 13:114251215-114251237 TCCCACTACCTCTCCAGGCAGGG - Intronic
1116220715 14:42084118-42084140 TGCCACTATCTCCTCCTGTAAGG + Intergenic
1116800830 14:49441452-49441474 TCCCATTTCCTCCTCTGTTTGGG - Intergenic
1122476259 14:102011823-102011845 TCCCCATTCCTCCTCTGGGATGG + Intronic
1122910211 14:104824150-104824172 TCCCACCTCAGCCTCTGGTATGG - Intergenic
1123008062 14:105333865-105333887 TCCCAGAACCCCCTCTGGGAAGG - Intronic
1123113366 14:105883043-105883065 CCCCACTGCCTCCCCTGCTAGGG - Intergenic
1123402701 15:20003471-20003493 CCCCACTGCCTCCCCTGCTAGGG - Intergenic
1123512040 15:21010125-21010147 CCCCACTGCCTCCCCTGCTAGGG - Intergenic
1123717905 15:23043502-23043524 TCCCACTAGCACCTCTGGCCAGG - Intergenic
1123718586 15:23045871-23045893 TCCCACTAGCACCTCTGGCCAGG - Intergenic
1125477324 15:40055892-40055914 TCTCTCTTCCTGCTCTGGTATGG - Intergenic
1128552707 15:68608646-68608668 TCCCAGTTCCTCCTCTCCTAGGG + Intronic
1129300009 15:74620022-74620044 TCCCGGTACCTCCTCTGGTAGGG - Exonic
1129772496 15:78211748-78211770 TCCCATCAGCTCCTCTGGCAAGG - Intronic
1131157449 15:90083937-90083959 TCCCACTACCTCCTCCCCTCAGG + Exonic
1138108518 16:54305036-54305058 TCCCACCATCTCTTCTGGGATGG + Intergenic
1138965591 16:62080388-62080410 TCCCTCGGCCTCCTCTGGTATGG - Intergenic
1141250825 16:82357537-82357559 TCCCCTTCCCTCCTCTGGGAGGG + Intergenic
1146137706 17:30337701-30337723 TCACAGTACTTTCTCTGGTATGG + Intergenic
1146958563 17:36952662-36952684 TCCCACTAGCTCCTTTTGTTAGG + Intronic
1147162166 17:38574666-38574688 TGCCACTACCTCCTCAGGCCTGG - Intronic
1147261679 17:39212655-39212677 TCCCTCCACCTCCTCTGTGATGG - Intronic
1148382480 17:47209905-47209927 TCCCACTACCTCCTAGGAAAAGG - Intronic
1149565868 17:57640074-57640096 TCCCCCCACCTCCTCTAGGAGGG - Intronic
1150489845 17:65566672-65566694 TCCCAGTCCCTCCTCTGCAAAGG - Intronic
1156030531 18:32707490-32707512 TCCCACTACCTTAGCTGATAAGG + Intronic
1157840159 18:50950117-50950139 TCCCACCACCACCTGTTGTATGG + Exonic
1159351395 18:67279524-67279546 GAACACTACCTCCTCTGGTTAGG + Intergenic
1161295633 19:3518934-3518956 TCCCACTACCTCCTCTGGTAGGG + Intronic
1161995597 19:7709521-7709543 TCCTCCTGCCTCCTCTTGTAAGG + Intergenic
1164888987 19:31806915-31806937 TCCCCCTTCCTCCTGAGGTAGGG - Intergenic
1165450118 19:35877636-35877658 TCCCACTTGCTCTACTGGTAGGG + Intronic
1168161384 19:54512690-54512712 TCACACAGCCTCCTCTGCTAAGG - Intergenic
1168368776 19:55813546-55813568 ACCCAGTACCTCTTCTGGGATGG - Intronic
926684670 2:15689763-15689785 TCCCACTTCCTCCTCCTGTGTGG + Intergenic
927342859 2:22002249-22002271 TCCCACTTCCTCTTGTGGTTAGG - Intergenic
927647723 2:24888527-24888549 TCACACTCCCTCCTGTTGTAGGG - Intronic
928193281 2:29193733-29193755 GCCTACCACCTCCTCTGGCAAGG - Exonic
928595886 2:32858472-32858494 TACCACTACCACCCCTGGGAGGG + Intergenic
931829852 2:66039447-66039469 TTCTACTGCCTCCTCTGATATGG - Intergenic
948596858 2:239085089-239085111 TCCCCCACGCTCCTCTGGTAGGG + Intronic
1169046552 20:2538065-2538087 TTCCACTCCCTCCTGTGGGAGGG + Intronic
1171044650 20:21798424-21798446 CCCAGCTCCCTCCTCTGGTATGG - Intergenic
1173382224 20:42556123-42556145 TCACACTATCTCCTCAGGCAGGG + Intronic
1174281937 20:49445798-49445820 TCCCCCTCCCTGCTCTGGCAGGG + Intronic
1179483842 21:41696475-41696497 TCCCTCTACCTCATCTGGACTGG - Intergenic
1182120256 22:27781813-27781835 TCCCACTATCTCCTGGGGCAGGG + Intronic
1182121015 22:27786758-27786780 TCCCACCACCTCCTCAGGACAGG - Intronic
1182619829 22:31613011-31613033 TCCCACTTCCTCCACTAGGAAGG - Intronic
1184559625 22:45254593-45254615 TCCCACTTTCATCTCTGGTAGGG - Intergenic
1184784971 22:46667187-46667209 CCCCACAACCTCCCCAGGTAGGG + Intronic
1185108249 22:48886206-48886228 TGCCACTAACTCCTCTGCTGTGG - Intergenic
1185121932 22:48976640-48976662 TCCTACCACCTGCTCTGGTTGGG - Intergenic
949240423 3:1864890-1864912 TCCTTCTACCTCCTCTAGCATGG - Intergenic
949463786 3:4322819-4322841 TCCCAGTAACTCCCCTGGCATGG + Intronic
949851819 3:8427831-8427853 TGCCACCACCTCTTCTGGGAGGG - Intergenic
951864231 3:27289361-27289383 TGCCACTACCTCCTCCTTTAAGG + Intronic
952192556 3:31039194-31039216 TACCCCTGCCACCTCTGGTAAGG + Intergenic
952655491 3:35780556-35780578 TCCCACTACTTACTCTGTGAGGG + Intronic
953721066 3:45355573-45355595 CCCCACTCACTCCTCTGGTTGGG + Intergenic
954624507 3:52015278-52015300 CCCCACTCCCTCCTGGGGTAGGG + Intergenic
955006868 3:54976799-54976821 TCCCACTCCCACTTCTGGTGTGG - Intronic
958510137 3:95037381-95037403 TACCAGTACCTGCTCTGGTGGGG + Intergenic
961655923 3:128441751-128441773 TGCCACTCCCTCCTCAGGTCAGG + Intergenic
962208355 3:133454586-133454608 TCCCACAACCTCCTCTGCAGAGG + Intronic
963444368 3:145384635-145384657 ACCCACTTGCCCCTCTGGTATGG + Intergenic
968687399 4:1970553-1970575 TCCCACTGCCCCTTCTGGTGGGG - Intronic
968954157 4:3709769-3709791 TCCCACAACCTCCCCAGGTCTGG + Intergenic
968966953 4:3773590-3773612 TCCCACTTCCTGCTCTGGCTTGG + Intergenic
969435098 4:7184763-7184785 CCTCACTACCCCCTCTGCTATGG + Intergenic
974967766 4:68783917-68783939 TCCTAATACCTCCTGTGGGATGG + Intergenic
974979229 4:68933435-68933457 TCCTAATACCTCCTGTGGGATGG - Intronic
975002902 4:69247267-69247289 TCCTAATACCTCCTGTGGGATGG + Intergenic
975011186 4:69354625-69354647 TCCTAATACCTCCTGTGGGATGG + Intronic
976605257 4:86976608-86976630 TCCCCCTCCATCCTCTGGTAGGG - Intronic
977156242 4:93577618-93577640 TCCCAGTAACTCCTGTGGTCTGG - Intronic
978761860 4:112361622-112361644 TTTCACTACCTTCCCTGGTAGGG + Intronic
985852207 5:2397175-2397197 TCCCACTGCCTCCTCTCCCAGGG + Intergenic
987818422 5:22932506-22932528 TCCCTCTACCTCCTCATCTATGG + Intergenic
989387338 5:40866846-40866868 TCACAATAGCTCCTGTGGTAAGG + Intergenic
989716479 5:44468748-44468770 TCCCAGTAGCTCCTTTGGAAGGG - Intergenic
990051361 5:51505631-51505653 TCCCTCTCTCTCCTCTGATATGG - Intergenic
990109177 5:52302968-52302990 TCCCACTACACCCTCTTCTAAGG + Intergenic
991217381 5:64171216-64171238 TCCCCCTCAGTCCTCTGGTAAGG - Intronic
991608780 5:68429214-68429236 TCCCATGACCTCCTCTGGACTGG + Intergenic
992726514 5:79612652-79612674 CACCACTACCTCCTTTGGTTCGG + Exonic
992968691 5:82031997-82032019 TCCCACTACCTTGTCTGGGCAGG - Intronic
993110134 5:83646681-83646703 TGCCACTAACTCCTGTGGTGAGG + Intronic
995458131 5:112373383-112373405 CAGCACTAGCTCCTCTGGTATGG + Intronic
999724095 5:154420657-154420679 GCCCACTGCCACCTCTGGGATGG + Exonic
1001763689 5:174227852-174227874 TCCCACTCCTTCCTCCGGCAGGG - Intronic
1002302911 5:178267634-178267656 TCCCACTGTGTCCTCTGGAAGGG + Intronic
1004176817 6:13347342-13347364 TCCCATTACTTCCTCCGGTGGGG + Intergenic
1004449322 6:15730482-15730504 TACCACTAACCTCTCTGGTAAGG - Intergenic
1006106263 6:31718811-31718833 TCCCAATCCCTCCTCAAGTAGGG + Exonic
1006183243 6:32166469-32166491 TCCCACCTCATCCTCTGGCATGG + Intronic
1010147109 6:72682960-72682982 TCTCACTACCTTCTCTGGAGAGG + Intronic
1011589017 6:88952728-88952750 TACCAGCACCTGCTCTGGTAGGG - Intronic
1015935539 6:138403855-138403877 TCCCACCACCTCCTCCGCAAGGG + Intronic
1017070258 6:150569891-150569913 TCCCACCACCACCTCTGGATGGG + Intergenic
1018489328 6:164275630-164275652 TCCCAAAACCTCTTCTGATATGG + Intergenic
1028325467 7:89518767-89518789 TTCCATTACCTCCACTGGTTTGG + Intergenic
1028522928 7:91752448-91752470 TCCCACTGCCTCCTTTGGCTGGG - Intronic
1033981342 7:147169972-147169994 GCCCACTACCTCCTCAGCAATGG - Intronic
1036645679 8:10610494-10610516 GCCCACATCCTCCTCTGGTGTGG - Exonic
1042094251 8:65194915-65194937 TCCCTCTGCCTCCTCTTTTAAGG - Intergenic
1042575618 8:70215383-70215405 TCCCACTGCCTCCCCAGGTAGGG + Intronic
1044300834 8:90581137-90581159 TCCCTCTGCCTTCTCTTGTAAGG + Intergenic
1044339228 8:91027855-91027877 CCTCACTACCTCCCCTGGGAAGG + Intronic
1047025391 8:120817985-120818007 TCCCACTGCCTTCTCTGGCAAGG + Intergenic
1048885663 8:138907274-138907296 TCCCACAAGCTCCCCTTGTAGGG - Intronic
1057501849 9:95602476-95602498 AGCCCCTACCTCCCCTGGTAGGG - Intergenic
1059427884 9:114232400-114232422 TCCCACTTCCAACTCTGGTTTGG - Intronic
1059543996 9:115158159-115158181 TCCCCCTCCTTGCTCTGGTATGG - Intronic
1060077660 9:120607638-120607660 TTCCAGAAACTCCTCTGGTAGGG + Intronic
1060216106 9:121739469-121739491 TCCCTCTGACTCCCCTGGTAGGG + Intronic
1062711087 9:137975570-137975592 CCCCAGGACCTCCTCTGGTGAGG + Intronic
1188403807 X:29781867-29781889 TATCACTACCTCCTTTGGAAGGG + Intronic
1190436656 X:50432224-50432246 TCCCACTGCTTCCTGTGCTAAGG + Intronic
1195251370 X:103051474-103051496 TCCCACGACCTCCCCTGGTGCGG + Intergenic
1195996512 X:110737087-110737109 CCCCACTATTTCCTCTGGAAAGG + Intronic
1197339918 X:125254999-125255021 TCCCATTTCTTCCTTTGGTATGG + Intergenic
1200226691 X:154421413-154421435 GCTCACTACCTCCTCAGGGATGG + Exonic
1200545063 Y:4509651-4509673 TCCGATTGCCTCCTCTGGAAAGG + Intergenic
1201963444 Y:19707161-19707183 TGCCACTGCCTTCTCTGATAGGG + Exonic