ID: 1161295918

View in Genome Browser
Species Human (GRCh38)
Location 19:3520157-3520179
Sequence GACCACTCCTGGGCCAGCAC TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 246
Summary {0: 1, 1: 0, 2: 0, 3: 17, 4: 228}

Found 9 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1161295918_1161295928 -1 Left 1161295918 19:3520157-3520179 CCAGTGCTGGCCCAGGAGTGGTC 0: 1
1: 0
2: 0
3: 17
4: 228
Right 1161295928 19:3520179-3520201 CGGGTGTGGTGGGGACACATGGG 0: 1
1: 0
2: 3
3: 27
4: 201
1161295918_1161295931 8 Left 1161295918 19:3520157-3520179 CCAGTGCTGGCCCAGGAGTGGTC 0: 1
1: 0
2: 0
3: 17
4: 228
Right 1161295931 19:3520188-3520210 TGGGGACACATGGGCCTTTGGGG 0: 1
1: 0
2: 2
3: 22
4: 217
1161295918_1161295930 7 Left 1161295918 19:3520157-3520179 CCAGTGCTGGCCCAGGAGTGGTC 0: 1
1: 0
2: 0
3: 17
4: 228
Right 1161295930 19:3520187-3520209 GTGGGGACACATGGGCCTTTGGG 0: 1
1: 0
2: 1
3: 20
4: 165
1161295918_1161295929 6 Left 1161295918 19:3520157-3520179 CCAGTGCTGGCCCAGGAGTGGTC 0: 1
1: 0
2: 0
3: 17
4: 228
Right 1161295929 19:3520186-3520208 GGTGGGGACACATGGGCCTTTGG 0: 1
1: 0
2: 2
3: 21
4: 234
1161295918_1161295933 15 Left 1161295918 19:3520157-3520179 CCAGTGCTGGCCCAGGAGTGGTC 0: 1
1: 0
2: 0
3: 17
4: 228
Right 1161295933 19:3520195-3520217 ACATGGGCCTTTGGGGCTGCGGG 0: 1
1: 0
2: 0
3: 20
4: 273
1161295918_1161295932 14 Left 1161295918 19:3520157-3520179 CCAGTGCTGGCCCAGGAGTGGTC 0: 1
1: 0
2: 0
3: 17
4: 228
Right 1161295932 19:3520194-3520216 CACATGGGCCTTTGGGGCTGCGG 0: 1
1: 0
2: 1
3: 38
4: 342
1161295918_1161295934 18 Left 1161295918 19:3520157-3520179 CCAGTGCTGGCCCAGGAGTGGTC 0: 1
1: 0
2: 0
3: 17
4: 228
Right 1161295934 19:3520198-3520220 TGGGCCTTTGGGGCTGCGGGAGG 0: 1
1: 0
2: 2
3: 27
4: 390
1161295918_1161295927 -2 Left 1161295918 19:3520157-3520179 CCAGTGCTGGCCCAGGAGTGGTC 0: 1
1: 0
2: 0
3: 17
4: 228
Right 1161295927 19:3520178-3520200 TCGGGTGTGGTGGGGACACATGG 0: 1
1: 0
2: 1
3: 27
4: 249
1161295918_1161295926 -10 Left 1161295918 19:3520157-3520179 CCAGTGCTGGCCCAGGAGTGGTC 0: 1
1: 0
2: 0
3: 17
4: 228
Right 1161295926 19:3520170-3520192 AGGAGTGGTCGGGTGTGGTGGGG 0: 1
1: 0
2: 1
3: 41
4: 512

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1161295918 Original CRISPR GACCACTCCTGGGCCAGCAC TGG (reversed) Intronic
900392880 1:2441351-2441373 GCCAGCTCCTGGGCCTGCACTGG + Intronic
900401850 1:2475973-2475995 GACCACTCCAGGCCCAGCCTCGG + Intronic
901657740 1:10780004-10780026 GGGCACTCCTGGCCCAGCTCAGG - Intronic
905936607 1:41828999-41829021 GGCCACCCCTGAGCCAGCTCAGG - Intronic
906654466 1:47537604-47537626 GAGGAATCCAGGGCCAGCACTGG + Intergenic
907045173 1:51296244-51296266 GACCTCACGTGGCCCAGCACAGG + Intronic
907271935 1:53296406-53296428 TCCCAGGCCTGGGCCAGCACAGG + Intronic
913178460 1:116296787-116296809 CACCAGTCCTGGGTAAGCACTGG + Intergenic
914753076 1:150549100-150549122 GACCCCGGCTGGGCCAGCCCGGG + Intergenic
914753100 1:150549185-150549207 GACCCCGGCTGGGCCAGCCCGGG + Intergenic
915005105 1:152628512-152628534 CCCCACTCCTGGGCCAGAACAGG - Intergenic
915507420 1:156366618-156366640 CACCAATCCTGGGCCAGGTCTGG - Intronic
917754299 1:178083924-178083946 CACTACTCCTGGGCCAGGAGTGG - Intergenic
920953544 1:210597247-210597269 CACCACTACTGGGACTGCACTGG + Intronic
921221687 1:212978258-212978280 GACCACCCCTGCGCCTGCAGAGG + Intronic
921263966 1:213407024-213407046 TCCCACACCTGGGCCAGCAAAGG - Intergenic
921563534 1:216687687-216687709 GACCACTCCAAGGTCAACACAGG + Intronic
923547346 1:234932356-234932378 GGACACACCTGGGGCAGCACAGG - Intergenic
923565490 1:235073243-235073265 AACAATTCCTGGGCCAGAACAGG + Intergenic
1063227877 10:4033403-4033425 CACCACGGCTGGGCCAGCCCTGG + Intergenic
1068065156 10:52121105-52121127 CAGCACTCCTGGGCCACCCCAGG - Intronic
1069391833 10:67944176-67944198 CACCACTACTGGGACTGCACTGG - Intronic
1070766300 10:79058360-79058382 CAGCTCTCCTGGGCCTGCACTGG + Intergenic
1071073917 10:81728991-81729013 GATTATTCCTGGGCTAGCACTGG - Intergenic
1071727492 10:88214255-88214277 GACCACTCCTGAGTCAGGGCAGG + Intergenic
1072696735 10:97609473-97609495 GTCCTCTCCTGTGCCAGCTCTGG + Intronic
1073815239 10:107199175-107199197 GACCACTTCAGAGCCAGGACTGG - Intergenic
1075153722 10:119956963-119956985 GGCCATCCCTGGGCCATCACTGG - Intergenic
1077051171 11:567789-567811 GACCACACCTGTGCCTGCCCAGG + Intergenic
1077168548 11:1154409-1154431 GTCCACTCCTGGGCCAGGGCAGG + Intergenic
1077693275 11:4368921-4368943 GTCCACTCCTGGAACACCACTGG - Intergenic
1078451866 11:11446526-11446548 GACCACTCCTGGGTCTGGAGAGG - Intronic
1080489726 11:32750261-32750283 GACCACCACTGGGACTGCACTGG + Intronic
1080556547 11:33422383-33422405 GAGCACTCCTGGTGCAGCAGTGG - Intergenic
1082877410 11:58002242-58002264 CACCACACCTGGCCAAGCACAGG + Intergenic
1083294302 11:61706999-61707021 GACCTCCCCTGGGCCAGCAGGGG + Intronic
1084219165 11:67667050-67667072 GACCCCTCCTGGCCCAGGTCTGG - Intronic
1084296647 11:68216473-68216495 TGCCACTCCTAGGCCAGCTCCGG - Intergenic
1084603462 11:70159842-70159864 GACCACTCCCTGGCCAGCTCCGG - Intronic
1084964880 11:72739319-72739341 CACCACACATGGGCCAGGACAGG - Intronic
1085829750 11:79886664-79886686 GAGCACTCATGGAACAGCACAGG + Intergenic
1088728150 11:112657469-112657491 GACCCCTCCAGGGCCTGCAGAGG - Intergenic
1090855962 11:130609543-130609565 TCCCACTCCTGGGCTAGCACAGG - Intergenic
1096234679 12:49918070-49918092 GCCCACTGCTGGGCCAGAAGAGG - Intergenic
1096460310 12:51818569-51818591 CAGCACTCCTAGGCCAGCACAGG + Intergenic
1096591849 12:52665297-52665319 GACCAATCCTGGGCCAGGGAGGG - Intergenic
1104035594 12:125095194-125095216 CAGCTCTCCTGGGCCAGGACAGG + Intronic
1106102633 13:26708008-26708030 CACCACTCCTGGACCTGCAGGGG - Intergenic
1106497804 13:30296814-30296836 GGCCTTTCCTGGGTCAGCACAGG - Intronic
1106674248 13:31941059-31941081 GAGCAATCCTGTGCCAACACAGG - Intergenic
1109262823 13:60163943-60163965 GGCCAGTCCCGGGCCAACACGGG - Exonic
1109793491 13:67279509-67279531 GGCCACTTCTGTGCCAGCAGGGG - Intergenic
1111542331 13:89685419-89685441 AACAAGTCCTGGGCCAGAACTGG - Intergenic
1112319483 13:98394118-98394140 GACCAGTTCTGTGCCAGCAAAGG - Intronic
1115038933 14:28897323-28897345 AACCACTCCTGGGCCAGGCGTGG + Intergenic
1116021531 14:39468299-39468321 GACCACCACTGGGACTGCACTGG + Intergenic
1118910602 14:70059181-70059203 GACCACTTCTGTGCCTGCGCTGG - Intronic
1119407010 14:74405335-74405357 GAGCCTGCCTGGGCCAGCACAGG - Intergenic
1119738062 14:76996568-76996590 CACCTCTCCTGGTTCAGCACAGG - Intergenic
1119868163 14:77991363-77991385 GATCACTCCTGGACCAGGAATGG - Intergenic
1120025015 14:79573510-79573532 AACCACTCGCAGGCCAGCACTGG + Intronic
1120722430 14:87903612-87903634 GACAGCTCCTTGTCCAGCACTGG - Intronic
1121254941 14:92524528-92524550 GACCACTCCTGGGGCATAAGAGG + Intronic
1121332120 14:93056209-93056231 GCCCACTCCTGGCCAAGCAGAGG + Intronic
1121602971 14:95219693-95219715 GGCCAAACGTGGGCCAGCACAGG - Intronic
1122820204 14:104339556-104339578 GACAACTCCTGAGCCAGCAAGGG - Intergenic
1123003854 14:105312034-105312056 GCCTCCTCCAGGGCCAGCACTGG - Exonic
1127363031 15:58261660-58261682 CACCACTCATTGGCCAGAACTGG + Intronic
1127867579 15:63044196-63044218 GGCCACTCCGGGGTCACCACAGG + Intronic
1128781136 15:70359434-70359456 GACGACTGGTGGCCCAGCACAGG - Intergenic
1129846681 15:78771065-78771087 GCTCACTGCTGGGCCACCACGGG - Intronic
1130327898 15:82896200-82896222 GGCTACTGCTGGGCCACCACAGG - Intronic
1131161783 15:90110077-90110099 GTCCATTCCTGGGTCAGGACTGG - Intergenic
1132537054 16:487460-487482 CACCACTGCTGGGACAGCTCAGG - Intronic
1132748206 16:1445665-1445687 GAGGACACCTGGCCCAGCACAGG - Exonic
1132851713 16:2027640-2027662 GACCCCTCCTGGGTACGCACAGG - Intronic
1134299158 16:12974236-12974258 GGCCACTCCTTGGCCAGGAGAGG + Intronic
1135297395 16:21294220-21294242 GACCACTCCTGTGCCAGGGAGGG - Intronic
1137859805 16:51834986-51835008 GAACACTCCTGGGCCTGGAGTGG - Intergenic
1140224127 16:73065192-73065214 TAGCCCTCCTGGGCCAGCGCCGG + Intergenic
1141928045 16:87182109-87182131 GTCCACTCCTGGGTTAGCACTGG - Intronic
1143440605 17:6970186-6970208 CACCACGCCTGGCCCAGCAGGGG - Intronic
1143712082 17:8742172-8742194 GACCACTCCCGGACCAGAGCTGG + Intronic
1144948655 17:18982485-18982507 CACCCCTCTTGGGCCAGCCCCGG - Intronic
1145039273 17:19565005-19565027 CACCACTCCTGGGCCAGTGCTGG + Intronic
1147460507 17:40565214-40565236 CACCCCTCCTGGGACAGCAGGGG + Intronic
1147622653 17:41878098-41878120 GACTACTCCTGGGCCAGGGTAGG - Exonic
1148054581 17:44786621-44786643 GACCAAGCCTGGGCCACCACTGG + Intergenic
1148349003 17:46925467-46925489 TCCCACTCCTGGTTCAGCACTGG - Intronic
1149630173 17:58115806-58115828 GACCACCCAGGGGCCAGCCCAGG - Intergenic
1151383768 17:73742965-73742987 GACCCCGCCTGGGCCAGGTCTGG - Intergenic
1151669881 17:75566185-75566207 GGCCACATCTGGACCAGCACGGG - Intronic
1151807111 17:76412628-76412650 GCCCACTCCACTGCCAGCACAGG + Intronic
1154163667 18:11998213-11998235 GACCAGTTCTGGTCCAGCCCAGG - Intronic
1157230167 18:45908231-45908253 GAGAACTCCTGGTCCAGCAGGGG + Intronic
1157724468 18:49953193-49953215 CACCACTCCCTGTCCAGCACTGG + Intronic
1157757524 18:50231928-50231950 CCCCTCTCCTGGGCCAACACAGG + Intronic
1158083835 18:53626360-53626382 GACTACTCCTGCGTCAGCGCTGG + Intergenic
1158480798 18:57820083-57820105 GACAACTCTGGGGACAGCACTGG - Intergenic
1159837185 18:73352606-73352628 GAGCACTGCTGGGCCAGAATGGG + Intergenic
1160416648 18:78716743-78716765 GAGCACTCGAGGGCCAGCGCGGG - Intergenic
1160420952 18:78743564-78743586 GACCACTTCTGGTCCATCAGAGG - Intergenic
1161295918 19:3520157-3520179 GACCACTCCTGGGCCAGCACTGG - Intronic
1162561329 19:11419458-11419480 GACCTCTCCTGGGCTGGCGCTGG - Intergenic
1162698646 19:12496750-12496772 GACCACTCTTGAGCCTGCAAAGG + Intronic
1163233987 19:16020536-16020558 GACAGTTCCTGGCCCAGCACAGG + Intergenic
1163517657 19:17774745-17774767 GAACAATCCTGGGCCAGCTTGGG - Intronic
1163679850 19:18674850-18674872 CACCACTCCTGGGACAGCTGGGG - Intergenic
1163700401 19:18784031-18784053 CACCACGCCTGGACCAGCATAGG + Intronic
1163815462 19:19462297-19462319 GGCCAATCCTCGGCCACCACAGG - Intronic
1163831292 19:19548271-19548293 CACCACGCCTGGGCCAGGAAGGG + Intergenic
1163860975 19:19742686-19742708 GACAGCTCCCGGCCCAGCACAGG + Intergenic
1165068230 19:33241169-33241191 GCCCACTCCTGGGCCTGGCCTGG + Intergenic
1166281728 19:41798511-41798533 AACCTCTCCTGGGCAAGGACAGG + Intronic
1166996882 19:46723639-46723661 GACCAACCCTTGTCCAGCACAGG - Intronic
1168687804 19:58358834-58358856 GACCCCAGCTGAGCCAGCACTGG - Intronic
924962259 2:45905-45927 GACCACTCCTGGCCCCGCGGCGG - Exonic
925393637 2:3517010-3517032 GACCTCTCCTGGGCCAGGCATGG - Intronic
925701956 2:6647772-6647794 GACCTCCCCTGCGCCAGCTCTGG - Intergenic
926019716 2:9484303-9484325 GACCCCACTTGGGCCAGCCCCGG - Intronic
928396638 2:30947670-30947692 AACCACCCTTTGGCCAGCACAGG + Intronic
929130894 2:38569889-38569911 GACCATTCCTGGTACAGCACTGG - Exonic
929578493 2:43067665-43067687 CCCAACACCTGGGCCAGCACCGG + Intergenic
932576229 2:72963782-72963804 GAGCCCTCCTGATCCAGCACAGG + Intronic
932873252 2:75425104-75425126 GCCCATTTCTGTGCCAGCACTGG - Intergenic
933727914 2:85436894-85436916 GACCAGTCAGGGGACAGCACAGG + Exonic
933747991 2:85584624-85584646 GACCACTGCTGGAGCAGGACGGG + Intronic
934986972 2:98894510-98894532 GGGCCCTCCTGGCCCAGCACTGG + Intronic
936093013 2:109512831-109512853 ACCCCCTCCTGGGCCAGCAAGGG + Intergenic
936531140 2:113277821-113277843 GACTCCTCCTGGCCCAGCACCGG - Intronic
937236933 2:120436812-120436834 TTCACCTCCTGGGCCAGCACAGG + Intergenic
937463325 2:122108380-122108402 GCCCACTCCAGGGGCAGCCCTGG + Intergenic
937487238 2:122327824-122327846 GACCAACCCTGGGCAAGCACAGG + Intergenic
937716302 2:125037410-125037432 TGGCGCTCCTGGGCCAGCACGGG + Intergenic
938087694 2:128412191-128412213 GGCCACTCTGGGGACAGCACTGG + Intergenic
939015742 2:136902043-136902065 TACTACTTCTGGGCCAGCCCAGG - Intronic
941223363 2:162813221-162813243 GACCATTCCTGGGCCTGCTTGGG - Intronic
942882004 2:180872025-180872047 CACCACTACTGGGACTGCACTGG - Intergenic
944227235 2:197360047-197360069 GGCCACACCTGGCCCAGCAGGGG - Intergenic
944309109 2:198213354-198213376 AACCACTCTTGGGCCTGGACAGG - Intronic
946302559 2:218832698-218832720 GTCCACTCCAGGGCCAGGGCTGG - Intergenic
946621994 2:221571793-221571815 GTCCTCTCCTGAGCCAGCCCGGG - Intronic
947089741 2:226496598-226496620 GCCAGCTCCTGGGCCAGCAGAGG + Intergenic
1168974820 20:1956363-1956385 GACCACACCTTGGGAAGCACTGG + Intergenic
1171049347 20:21840704-21840726 GACCTCTCCTGGGCTAGCTTAGG - Intergenic
1172193791 20:33078232-33078254 CCCCACTCCTAGGCCAGCACAGG - Intergenic
1172962314 20:38807388-38807410 GAACACTCCTTGGCCAATACTGG + Intronic
1173850079 20:46212292-46212314 GACCACTTGTGGGCCAGTGCAGG + Intronic
1174180600 20:48672046-48672068 CACAACTCCTCGGCCAGCACTGG + Intronic
1174368685 20:50071767-50071789 GCTGACTCCTGGGCCTGCACTGG + Intergenic
1175200071 20:57270625-57270647 GAAAACTCCTGGCCCAGCACTGG - Intergenic
1175297713 20:57920650-57920672 GACAGCTCCTGACCCAGCACTGG - Intergenic
1175551291 20:59819649-59819671 GGCCAGTACTGGGACAGCACCGG - Intronic
1175551303 20:59819699-59819721 GGCCAGTACTGGGACAGCACTGG - Intronic
1178552214 21:33550648-33550670 GGCAACTCCTGTGCCATCACAGG - Exonic
1180086413 21:45509769-45509791 GACCACTGCTTGGCCACCAGAGG - Intronic
1181080363 22:20410501-20410523 CACCACTCCCTGGCCAGCATGGG + Intergenic
1181635006 22:24170423-24170445 GCCCGCTCCTGAGCGAGCACAGG + Intronic
1183686877 22:39366190-39366212 GATCACTCCTGGGTGAGCCCAGG - Intronic
1185117494 22:48945961-48945983 GACCACGCCTCCTCCAGCACTGG - Intergenic
950140528 3:10612092-10612114 TACAACTCCTGGCTCAGCACTGG + Intronic
950215655 3:11156358-11156380 GACCACTCCCAGCCCAGCATTGG - Intronic
952821940 3:37493408-37493430 GACCACTCCTGGGCACCCTCAGG - Intronic
953448868 3:42990038-42990060 CACCACACCTGGCCCTGCACAGG - Intronic
953569119 3:44057509-44057531 GGCCCATCGTGGGCCAGCACTGG + Intergenic
954316929 3:49806335-49806357 GTCCAGGCCGGGGCCAGCACAGG + Intronic
954655937 3:52194376-52194398 GATCACAACTGGGCCAGAACAGG + Intergenic
958433659 3:94071919-94071941 AACCCCTCCTGTGCCTGCACTGG - Intronic
958814622 3:98901754-98901776 GGCCAATCCTCGGCCAGCTCTGG + Intergenic
961524284 3:127486710-127486732 GGCCTCTCCTGAGCCAGGACTGG + Intergenic
961740929 3:129032804-129032826 GTCCACTGCTGGGGAAGCACAGG - Exonic
962753516 3:138451571-138451593 CCCCACTCCTGGGGAAGCACAGG - Intronic
968811538 4:2801614-2801636 GGCCACTCACAGGCCAGCACAGG - Intronic
968972971 4:3805690-3805712 GACCAGTCCTGGGGCATCGCAGG - Intergenic
969519655 4:7668573-7668595 GACCTCTCCTGAGCCAGAAATGG + Intronic
969605277 4:8199320-8199342 GGCCGCTCCTGGCCCAGCGCTGG - Intronic
969690574 4:8701899-8701921 GGCCACTCCCAGGCCAGCATCGG - Intergenic
969841829 4:9888572-9888594 GGCCTCTCCTGGGGCAGCCCTGG - Intronic
971198059 4:24488065-24488087 GCCCACTCCTGTGCCAGAGCTGG - Intergenic
975256543 4:72242806-72242828 GAACACTCCAGGCCCAGCCCTGG + Intergenic
975365475 4:73523515-73523537 CACCACTGCTGGGACTGCACTGG + Intergenic
975675186 4:76820937-76820959 CACCACCCCTGGGCCTGCGCTGG + Intergenic
981751423 4:148095762-148095784 GCCCATTCCTGGGCAGGCACTGG - Intronic
982273809 4:153619266-153619288 GTCCACTCAAGGGCCAGCAAAGG - Intronic
984576449 4:181453813-181453835 GAACTCCCCTTGGCCAGCACAGG + Intergenic
996398018 5:123032640-123032662 CCCCACCCCTGGCCCAGCACTGG - Intronic
997403245 5:133619106-133619128 CACCTCTCCTCAGCCAGCACTGG - Intergenic
997640190 5:135443844-135443866 CAGCACTCCTGGGCCATTACTGG - Intergenic
999239463 5:150119065-150119087 GACTACGCCTGGGTGAGCACAGG + Intronic
1002345491 5:178545296-178545318 GCCCCCTGTTGGGCCAGCACAGG - Intronic
1003509379 6:6766680-6766702 GTCAACTCCTGAGTCAGCACTGG - Intergenic
1004498748 6:16189820-16189842 GAACACTCCTGTGCTACCACAGG - Intergenic
1007784528 6:44272103-44272125 AACAACTCCTGGGCCAACCCTGG + Intronic
1009482175 6:64172674-64172696 TCCCACCCCTGGGCCAGTACTGG - Intronic
1009510211 6:64541196-64541218 GACCCCTCCAGAGCCAGCTCAGG - Intronic
1012522390 6:100136742-100136764 GGCCTTTCCTGGGTCAGCACAGG - Intergenic
1015868528 6:137752380-137752402 GACCACAACTGGGCCAGGAAAGG - Intergenic
1017593042 6:155997497-155997519 GACAACTCTTGGGCCCGGACTGG + Intergenic
1017856932 6:158357716-158357738 GGGCAAGCCTGGGCCAGCACTGG - Intronic
1017899486 6:158706584-158706606 GACCAGTCCTCGTCCAGCAGGGG - Intronic
1018565977 6:165153558-165153580 GGCCACTCCTAGGCCTGCAATGG - Intergenic
1019303788 7:322754-322776 GACCCCTCCTAGGTCAGGACAGG - Intergenic
1023347815 7:39289241-39289263 GGCCACTCCAGCCCCAGCACTGG + Intronic
1028895891 7:96041008-96041030 CACCACACCTGGCCCAGCAGTGG + Intronic
1029039438 7:97557216-97557238 GAACACTCATGGGCCAGGAATGG - Intergenic
1029345608 7:99976349-99976371 GACAACCCCTGGGCCAGTAGGGG + Intergenic
1030343386 7:108406071-108406093 GACTATTCCTGGCCTAGCACAGG + Intronic
1030873097 7:114781825-114781847 GACCAGTCCTGAGGCATCACTGG - Intergenic
1031680574 7:124668543-124668565 TGCCACTCCTGGAGCAGCACAGG - Intergenic
1034399438 7:150852424-150852446 GGCCCCTCCTAGGCCAGCTCAGG + Intronic
1035317530 7:158006123-158006145 TGCCTCTCCTGGGGCAGCACAGG + Intronic
1037037027 8:14180588-14180610 GAGCACTCCTGGAACAGTACTGG - Intronic
1037723844 8:21467157-21467179 CACCACTCCCGGGCCAGCTGAGG - Intergenic
1038397321 8:27256953-27256975 GGCCACTCCTGGAACAGCTCTGG - Intronic
1039512864 8:38105591-38105613 GACCGCTCCTGGGCCAGGCCCGG - Exonic
1040277964 8:46023586-46023608 GACCACCCCGGGCCCAGCATAGG + Intergenic
1040304018 8:46202780-46202802 CAGCACTCCTGGGGCAGCCCTGG - Intergenic
1040338162 8:46426692-46426714 GAGCACTCCTGGGATAGCCCTGG - Intergenic
1049198821 8:141329926-141329948 GTCCGCACCTGGGGCAGCACAGG + Intergenic
1049238267 8:141523644-141523666 CACAACTCGTCGGCCAGCACTGG - Intergenic
1049519348 8:143080304-143080326 GACCACTCCTGCCCCACCCCAGG + Intergenic
1049566913 8:143345099-143345121 GGCTCCACCTGGGCCAGCACAGG + Intronic
1052024472 9:23559234-23559256 GACCACTCCTGGGACAACTGTGG - Intergenic
1052319372 9:27150981-27151003 TACAACTCCTGGGTGAGCACAGG + Intronic
1052858213 9:33420269-33420291 GACCATTCATGGTCCAGCCCGGG - Intergenic
1053302182 9:36960141-36960163 GACTCCTCCTGGGCCCGGACAGG + Intronic
1056369769 9:85941695-85941717 GACCTCTCCCGGGCCAGAGCCGG - Intronic
1057207947 9:93184578-93184600 GAACCCTCCTGGGCCAGGGCTGG + Intergenic
1057221150 9:93258650-93258672 GATCACCCCTGGTCCAGCGCAGG - Intronic
1057308101 9:93924274-93924296 TACCAGGCCTGGGCCACCACAGG + Intergenic
1057644545 9:96860349-96860371 CACCACCACTGGGACAGCACTGG - Intronic
1061276456 9:129571634-129571656 GACGTTCCCTGGGCCAGCACAGG + Intergenic
1062114729 9:134802260-134802282 GGCCAGACCTGGGCCAGCTCAGG + Intronic
1062186743 9:135222308-135222330 GACCACTCCAGGGCCAGGTGTGG + Intergenic
1188025170 X:25200944-25200966 GAGCATTCCAGGGCCAGGACCGG + Intergenic
1189271853 X:39757694-39757716 GACAACTCCTGGCCCAACTCTGG + Intergenic
1189792939 X:44620692-44620714 CACCACTCCTGGCCCCTCACAGG - Intergenic
1191251539 X:58262348-58262370 GACCCCTACGGGCCCAGCACAGG - Intergenic
1191251873 X:58263707-58263729 GACCACTGCGGGCCCAGCGCCGG - Intergenic
1191253735 X:58271003-58271025 GAACACCCCGGGCCCAGCACAGG + Intergenic
1194217349 X:91147621-91147643 CAGCACTCCTGGGCTACCACTGG + Intergenic
1198123614 X:133620541-133620563 GACCACTCCTTGCTCAGCCCAGG + Intronic
1198266652 X:135015810-135015832 GTTCATTCCTAGGCCAGCACAGG - Intergenic
1199005831 X:142694452-142694474 TACCACTGCTGGGACTGCACTGG - Intergenic
1200553864 Y:4611413-4611435 CAGCACTCCTGGGCTACCACTGG + Intergenic
1201077165 Y:10196856-10196878 GACCACTCCTGGTACCGCGCAGG + Intergenic