ID: 1161297220

View in Genome Browser
Species Human (GRCh38)
Location 19:3526198-3526220
Sequence GTGGGGGCCTGCAGGGCGGA TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 587
Summary {0: 1, 1: 0, 2: 5, 3: 47, 4: 534}

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1161297220_1161297237 24 Left 1161297220 19:3526198-3526220 CCATCCGCCCTGCAGGCCCCCAC 0: 1
1: 0
2: 5
3: 47
4: 534
Right 1161297237 19:3526245-3526267 CTTGGTGCCCGCAGACGGCCTGG 0: 1
1: 0
2: 0
3: 13
4: 92
1161297220_1161297231 6 Left 1161297220 19:3526198-3526220 CCATCCGCCCTGCAGGCCCCCAC 0: 1
1: 0
2: 5
3: 47
4: 534
Right 1161297231 19:3526227-3526249 TTGCCCCGCCTCACTGTGCTTGG 0: 1
1: 0
2: 1
3: 7
4: 137
1161297220_1161297236 19 Left 1161297220 19:3526198-3526220 CCATCCGCCCTGCAGGCCCCCAC 0: 1
1: 0
2: 5
3: 47
4: 534
Right 1161297236 19:3526240-3526262 CTGTGCTTGGTGCCCGCAGACGG 0: 1
1: 0
2: 0
3: 10
4: 125

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1161297220 Original CRISPR GTGGGGGCCTGCAGGGCGGA TGG (reversed) Intronic
900183784 1:1323952-1323974 CTGGGGGTCTGCTGGGCTGAGGG + Intronic
900225761 1:1533009-1533031 GTGGGCGCTTGCAGAGGGGACGG + Intronic
900316131 1:2057312-2057334 CTGGGGGTCTGCAGGGCGTCTGG + Intronic
901014592 1:6221027-6221049 GTGGTGGCCTGCAGGGCAAAAGG + Exonic
901016621 1:6235674-6235696 GCGGGGGCCGGCGGGGCGGGCGG - Intronic
901324948 1:8360429-8360451 GTGGAGGCCTGTAGGGGGGTGGG + Exonic
901325221 1:8361273-8361295 GTGGGAGCCTGCAAGGCTGGGGG + Exonic
901656100 1:10770596-10770618 GTGGGAGCATGCAGGACAGAGGG - Intronic
902336788 1:15758743-15758765 GAGGGGGCGGGGAGGGCGGACGG + Intronic
902916763 1:19644354-19644376 GAGGCGGCCGGCAGGGCGGGGGG - Intronic
903247738 1:22028540-22028562 GTGGGGGGCGGCGGGGCGGGAGG - Intergenic
903331069 1:22597540-22597562 GTGGGGGCACCCAGGGCAGAGGG + Intronic
903421055 1:23217783-23217805 GTAGGGGTCTGCAGGGAGGTGGG + Intergenic
903931299 1:26863981-26864003 GTGGGGGACTGGAGGGGGCAGGG - Exonic
904297021 1:29526478-29526500 GTGGTGGCCTGGAGGGGAGAAGG - Intergenic
904311586 1:29632789-29632811 CTGGGGGGCTGGAGGGCTGAGGG - Intergenic
905375007 1:37514389-37514411 GAGGGGGCGTGGAGGGAGGACGG - Intronic
906104987 1:43286244-43286266 GTGGGGACTTGCAGGGTAGAGGG - Intergenic
906356981 1:45115381-45115403 CTGGGCGGCTGCTGGGCGGAGGG + Intronic
906566327 1:46803758-46803780 TGGTGGGCCTGCAGGGAGGAGGG + Intronic
907011602 1:50968626-50968648 GCGAGCGCCAGCAGGGCGGAGGG + Exonic
907140559 1:52181835-52181857 CGGGGCGGCTGCAGGGCGGAGGG - Intronic
907437661 1:54459788-54459810 GTTGGGGCCTCCTGGGAGGATGG + Intergenic
907457166 1:54583153-54583175 GTGGAGGCCTGCAGGGTGCCAGG - Intronic
907490566 1:54806359-54806381 GTGGGGGCCGGCAGTGAGGAGGG + Intronic
908355357 1:63322191-63322213 GTGGGGGGGAGAAGGGCGGAAGG + Intergenic
910673784 1:89798018-89798040 GGGGGCGGCTGCCGGGCGGAGGG + Intronic
910891657 1:92026129-92026151 CTGGGCGGCTGCCGGGCGGAGGG + Intergenic
911696569 1:100896014-100896036 GGCGGGGCCTGCGCGGCGGAGGG - Intergenic
912497260 1:110099683-110099705 GAGGGGGCCGGCAGGGAGGGAGG + Intergenic
914448918 1:147773575-147773597 GGGGAGGGCTGCAGGGAGGAGGG - Intergenic
915243672 1:154541573-154541595 GTTGGGGGCTGCAGGGCTGTGGG + Intronic
916236379 1:162592871-162592893 TTGGGGGTCTGGAGGGAGGATGG + Intronic
917512776 1:175681892-175681914 ATGGGGGTCTGAAGGGAGGAAGG + Intronic
917535734 1:175873072-175873094 GTGGGGGGCTGAAGGGAGGAGGG - Intergenic
918125612 1:181580790-181580812 GTGGGGACCTGGAAGGAGGAGGG + Intronic
919753595 1:201053267-201053289 GGTAGGGCCTGCAGGGCGGGCGG + Exonic
919881361 1:201903335-201903357 CTTGGGGCCTGCAGGGCAGGAGG - Intronic
920108249 1:203569575-203569597 GCTGGGGCCTGCAGGGCAGCGGG + Intergenic
920750170 1:208666811-208666833 CTTGGGGCCTGCTGGGCTGATGG + Intergenic
921063948 1:211609625-211609647 GTTGGGGGCTGCAGGGGGCATGG - Intergenic
921261458 1:213388440-213388462 GTGGGGGCCTGGTGGGGGGCAGG + Intergenic
922340033 1:224647740-224647762 CTGGGAGCCAGCAGGGCAGAGGG + Intronic
922466525 1:225848696-225848718 GTGGGGGAGTGCAGGGATGAGGG + Intronic
923042274 1:230327736-230327758 GTGCGGGCCTGCAGTGCCCAAGG + Intronic
923089516 1:230729148-230729170 GTGGTGCCCTGCATGGCAGATGG - Intergenic
923499543 1:234553400-234553422 GTGGGAGCCTGAAGTGGGGATGG - Intergenic
923631065 1:235649842-235649864 GTCGGGCCCTGCAGGGCGGGAGG - Exonic
924708415 1:246516393-246516415 GTGGGGGGCAGCAGGATGGAGGG - Intergenic
924716966 1:246584685-246584707 GTGGAGGACTGCAGGGCTGCCGG - Intronic
1062911456 10:1215049-1215071 GTAGGGGCCTGCAGGGGCGGGGG + Intronic
1063646463 10:7888518-7888540 GTGGAGGTCTGCAGTGTGGAGGG + Intronic
1063807176 10:9658825-9658847 GTGAGGGACTGCAGTGCTGAGGG - Intergenic
1064203938 10:13306916-13306938 GTGGGGGCCAGCAGTGGGGAAGG - Intergenic
1064204656 10:13312904-13312926 GCGGGGGCCAGCAGGGTGGCAGG - Intergenic
1065738068 10:28771968-28771990 CTGGGCGGCTGCAGGGCAGAGGG - Intergenic
1066602903 10:37126198-37126220 CGGGGTCCCTGCAGGGCGGAGGG + Intronic
1067049245 10:43002594-43002616 CTGTGGGCCTGGAGGGCAGATGG + Intergenic
1067683058 10:48452160-48452182 GTGGGGGCCTGCAGCGGAGGTGG + Intronic
1068725339 10:60294502-60294524 TAGGGGGCTTGCAGGGAGGATGG + Intronic
1068803059 10:61163320-61163342 TTGGAGGTCTGCAGGGCAGAAGG + Intergenic
1069892644 10:71661799-71661821 GAGGGGGCGTGCAGGGTGGGAGG - Intronic
1069902820 10:71715727-71715749 GAGGGGGTCTGCAGAGAGGAAGG + Exonic
1070768258 10:79068564-79068586 GCTGGGGCCTGCAGGGGGGCTGG + Intergenic
1070948233 10:80410380-80410402 GAGCGGGCCTGCAGGCCAGAGGG + Intronic
1073053429 10:100684023-100684045 CTGGGGGGCTGCAGGGGGGAGGG + Intergenic
1074086218 10:110210329-110210351 GAGGGGGGCTGCGGGGCCGAGGG - Intronic
1074226272 10:111487622-111487644 GTGGGGGTTTGCAGGGAAGATGG - Intergenic
1074772014 10:116741152-116741174 GTGGGGGAGTGCAGGGTGGCGGG - Intronic
1075061652 10:119261101-119261123 CTGGGTGGCTGCCGGGCGGAGGG + Intronic
1075644345 10:124087711-124087733 GAGGGGGCCTGGAGGGCGGGGGG - Intronic
1076028839 10:127140928-127140950 CTGGGGGCCTGCCTGGTGGAGGG + Intronic
1076064991 10:127441727-127441749 GGGGAGGCCCGCAGGGGGGAAGG - Intronic
1076684894 10:132194138-132194160 GTGGGTGGCTGCAGGGAGGCTGG + Intronic
1076697466 10:132253879-132253901 GCGGGTCCCTGCAGGGCGGGAGG - Intronic
1076851598 10:133095991-133096013 GTGGGTGCCAGCAGGGGTGAGGG - Intronic
1076886863 10:133267016-133267038 CTGGGGCCCTGCAGGACAGATGG - Intronic
1077292914 11:1807740-1807762 GTGTCTCCCTGCAGGGCGGAGGG + Intergenic
1077326680 11:1967013-1967035 CTGGGGGGCTGCAGGGCCGCCGG + Intronic
1077358081 11:2127786-2127808 CTGGGGGACTGCAGGGCTGGGGG + Intergenic
1077365351 11:2159334-2159356 AGGGGGTCCTGCAGGGCGGGGGG - Intronic
1077839664 11:5961015-5961037 GGGGGCGGCTGCCGGGCGGAGGG - Intergenic
1078390375 11:10931425-10931447 GCGCGGGCCTCCAGGGCGGGAGG + Intergenic
1079135394 11:17773551-17773573 CTGGGGGCCGGGAGGGGGGAGGG + Intronic
1083208272 11:61166498-61166520 CTGGGCGGCTGCCGGGCGGAGGG + Intergenic
1083253448 11:61482571-61482593 GTGGGAGGGTGCAGGGAGGAGGG + Intronic
1083319214 11:61834996-61835018 CTGGGGGCAGGCAGGGAGGAGGG - Intronic
1083445652 11:62706511-62706533 CTTGGGGCCTGCAGGGAGGCAGG - Intronic
1083665495 11:64271879-64271901 GAGTGGGCCTGCAGAGCTGATGG - Intronic
1083737657 11:64690802-64690824 CTGGGGGCCTCCAGTGCTGAGGG - Intronic
1083764850 11:64836801-64836823 GTGGGGGCGTGCAGGGCCTCTGG + Exonic
1083945676 11:65921315-65921337 TCGGGGGGCTGCAGGGCAGAAGG - Exonic
1084006560 11:66326411-66326433 GTGGAGGGGTGGAGGGCGGAGGG + Intergenic
1084413607 11:69017846-69017868 GTGGGTGGCTGCAGGGCAGGAGG + Intergenic
1084553734 11:69863999-69864021 GTGAGGGCCTGGAAGCCGGAGGG - Intergenic
1085052981 11:73389221-73389243 CTGGAGGGCTGCAGGGCTGAGGG - Intronic
1085120562 11:73964917-73964939 TTGGGGGGCTCCAGGGCCGAGGG + Exonic
1085791322 11:79500007-79500029 CTGGGCGGCTGCCGGGCGGAGGG - Intergenic
1088194040 11:107256529-107256551 GTGGAGGCCTGCAGGGCTTTTGG - Intergenic
1089532110 11:119136907-119136929 GTGGGCTCCTGGAGGGAGGAGGG + Intergenic
1089608555 11:119656517-119656539 GTGGGGGCTTTCAGGGATGAGGG + Intronic
1090686709 11:129129379-129129401 CTGGGCGGCTGCCGGGCGGAGGG - Intronic
1090747665 11:129720307-129720329 GGCTGGGCCTGCAGGGCTGAGGG - Intergenic
1091172610 11:133531867-133531889 GTTGGGACCTGCAGGGTGGAAGG - Intronic
1091277209 11:134360598-134360620 GTGGGTGCCTGGAGGTGGGAGGG - Intronic
1202809661 11_KI270721v1_random:22193-22215 CTGGGGGGCTGCAGGGCCGCCGG + Intergenic
1091792623 12:3280504-3280526 GTGGGGCCAGGCAGGGAGGAGGG + Intronic
1092229000 12:6766628-6766650 GAGGGGCCCTGGACGGCGGAGGG - Exonic
1092427656 12:8387388-8387410 GTGGGGGCGTGGAGGGTGGGGGG - Intergenic
1092428922 12:8394369-8394391 GTGGGGGCGTGGAGGGTGGGGGG - Intergenic
1092502676 12:9064618-9064640 GTGGCGGCTTCCAGGGCGGCAGG - Intergenic
1092879316 12:12875706-12875728 CTGGGGGCCTGGAGGGGGTAGGG - Intergenic
1092981476 12:13799223-13799245 GTGGGGACCTGCAGGGGGAAGGG - Intronic
1093427996 12:19051142-19051164 GTGGGGGCCTGTTGGGGGGTGGG - Intergenic
1094166669 12:27450287-27450309 GTGGGGGCAGGGAGGGAGGAGGG - Intergenic
1094239063 12:28201232-28201254 CGGGGCGGCTGCAGGGCGGAGGG + Intronic
1095565113 12:43613839-43613861 GTGGGGGGCTGGAGGGGAGAAGG - Intergenic
1096215591 12:49796112-49796134 GTGGGCACCTGCAGTGGGGATGG + Exonic
1096968666 12:55648402-55648424 CTGGGCGGCTGCCGGGCGGAGGG + Intergenic
1097007147 12:55927685-55927707 GGAGGGGCGTGCAAGGCGGAGGG + Intronic
1097029143 12:56079425-56079447 GTGGGGGGCAGCAGAGGGGACGG + Intergenic
1097053654 12:56237938-56237960 GTAGGGGCCTGGAGGGTGCAGGG + Exonic
1099173419 12:79392959-79392981 GTGGGGGCCTGCTCGGGGGTGGG - Intronic
1100385215 12:94099729-94099751 GTGGAGGCAGGCAGGGCGGTGGG + Intergenic
1101655913 12:106720082-106720104 GTGGTGGGCTGCAGGGCCCAAGG - Intronic
1102569778 12:113820434-113820456 GTGGGAGCCTGCAGGGAGGAAGG + Intronic
1102683044 12:114703384-114703406 TTGGGAGCCTGCAGGGGGCAGGG - Intergenic
1102691270 12:114763015-114763037 GTGGGGGCAGGGAGGGTGGAAGG - Intergenic
1103649355 12:122421664-122421686 GTGGGGCTGTGCAGGGAGGAGGG + Intronic
1104074152 12:125374620-125374642 GTCGGGGGGTGCAGGGCAGAGGG - Intronic
1104367671 12:128192685-128192707 GTGGGGGCAGGTAGGGCTGAGGG - Intergenic
1104771644 12:131367696-131367718 GATGGGGCCTGCAGGGCAGCGGG + Intergenic
1104963693 12:132499704-132499726 CTGGGGGGCTGCAGGGCTGGGGG + Intronic
1105223908 13:18409260-18409282 GGGGCGCCCTGCAGGGCGGAGGG + Intergenic
1105847313 13:24304556-24304578 GTGGGGGGCTGCAGGGGAGAAGG - Exonic
1105976819 13:25480359-25480381 CTGGGTGGCTGCCGGGCGGAGGG + Intronic
1107883502 13:44854640-44854662 AGGAGGGGCTGCAGGGCGGAGGG - Intergenic
1113637513 13:111929707-111929729 GGGGGGGCATGGAGGGAGGAAGG + Intergenic
1113643537 13:111975991-111976013 GTGGGCGCCTGCCGGGAGGAGGG + Intergenic
1114008054 14:18334086-18334108 GGGGCGCCCTGCAGGGCGGAGGG + Intergenic
1114356434 14:21914491-21914513 GTGAGGGCCTGCAGGGTGTGTGG + Intergenic
1114490132 14:23095306-23095328 AAGGGGCGCTGCAGGGCGGATGG - Exonic
1114712760 14:24795048-24795070 GTGGGGGGTTGGAGGGAGGAGGG - Intergenic
1116633959 14:47369535-47369557 CTGGAGGACTGCAGGGTGGAGGG - Intronic
1117971476 14:61255016-61255038 GTGTGGGACTGCAGTGAGGATGG - Intronic
1119314732 14:73683602-73683624 GTGGGGGGCTGAGGGGAGGATGG - Intronic
1121050432 14:90816316-90816338 GGTGGGGCCTGCGGGGCGGGCGG - Exonic
1121469206 14:94138882-94138904 GTGGGGGTGAGCAGGGCTGACGG + Intergenic
1122276398 14:100592935-100592957 GTGGGGGCCTGCCGGGCTCTGGG - Intergenic
1122309390 14:100785002-100785024 CTGGGAGCCGGCAGGGCAGAAGG - Intergenic
1122703355 14:103605087-103605109 CTGGGGTACTGCTGGGCGGAAGG - Intronic
1122802524 14:104238807-104238829 GTGGGGGCCTGAAGGACTGTAGG + Intergenic
1122884785 14:104706181-104706203 GCTGGGGGCTGCAGGGCGGAGGG + Intronic
1202904153 14_GL000194v1_random:59039-59061 GAGGGGGCATTCAGGGCGGTGGG + Intergenic
1124483605 15:30098030-30098052 GAGGGAGCCTGCAGGGCAGCCGG - Intergenic
1124519973 15:30399196-30399218 GAGGGAGCCTGCAGGGCAGCCGG + Intergenic
1124538681 15:30567028-30567050 GAGGGAGCCTGCAGGGCAGCCGG - Intergenic
1124759969 15:32440554-32440576 GAGGGAGCCTGCAGGGCAGCCGG + Intergenic
1124922435 15:34039294-34039316 GTGGGGGTCTGCAGCGGGGCGGG + Intronic
1125723918 15:41858579-41858601 GTGAGGCCCTGCAGGCAGGAGGG - Intronic
1128153014 15:65375306-65375328 GTGCTGGACTGCAGGGTGGAGGG - Exonic
1128217639 15:65945383-65945405 GTGTGGGGCTGCAGGCCTGAGGG + Intronic
1128514666 15:68334863-68334885 GTGTGGGCAGGCAGGGTGGAGGG + Intronic
1129054149 15:72807274-72807296 GGGGGTGGCTGCCGGGCGGAGGG + Intergenic
1129644407 15:77417443-77417465 GTGGGGGGATGCGGGGCGGGGGG + Intronic
1129789867 15:78333766-78333788 CTGGTGGCCTGCATGGAGGATGG - Intergenic
1130011023 15:80152948-80152970 GTGGGGGCGGGCAGGGGGGCGGG + Intronic
1130296117 15:82647878-82647900 GTGTGGCCCTGCGGGGCTGACGG + Intronic
1132485821 16:190340-190362 GTCGGGGCCTGCAGGGTGACAGG - Intronic
1132676796 16:1124391-1124413 GGGGCGGCCAGCAGGGCGGAGGG - Intergenic
1132741296 16:1414584-1414606 GCGGGGGGCCGCAGGCCGGACGG + Intronic
1132885043 16:2178869-2178891 GGCGGGGCCTGGCGGGCGGAGGG - Intronic
1132954678 16:2585426-2585448 GTGCGGCCCTGCAGGGAGGGAGG - Intronic
1133271474 16:4612809-4612831 GTGGGGGCCGCCAGGGAGGCTGG - Intronic
1133371551 16:5249239-5249261 CTGGGGGCCTTCAGGAAGGATGG + Intergenic
1134020575 16:10918562-10918584 CTGGGGGGCTGCAGAGCGCAGGG + Intronic
1134042475 16:11079059-11079081 GTGTGGGGCTGCAGGGCTGCAGG - Intronic
1136006937 16:27337186-27337208 GTGGAGCCCTGCTGGGGGGAGGG + Intronic
1136025175 16:27464245-27464267 GTGAGGCCCATCAGGGCGGAGGG + Intronic
1136340670 16:29641010-29641032 GGGGGAGCCTCCAGGGCAGAGGG + Intergenic
1136408717 16:30064561-30064583 GTGGGGCCCGGCATGGGGGAAGG - Intronic
1138265323 16:55656119-55656141 TCGGGGGCCGGCAGGGCGCAAGG + Intronic
1138282686 16:55784035-55784057 GAGGGGGCCTGCATGGGGGAAGG + Intergenic
1138350190 16:56342209-56342231 GTGTGGGCCTGGAGTGGGGAAGG + Intronic
1139475344 16:67200060-67200082 GCGGGGGCCTCCGGGGCGGGGGG - Intronic
1139482202 16:67236796-67236818 GGTGGGGCCTGCGGGGCGGGAGG + Intronic
1139908160 16:70380795-70380817 GGAGGGGGCTGCACGGCGGAAGG - Exonic
1140190575 16:72812366-72812388 GTGGGGGGCAGTAGGGCTGAGGG + Intronic
1140890226 16:79278794-79278816 TTGGGGGCCAGCAGGCAGGAAGG - Intergenic
1141524679 16:84603981-84604003 GTGGGGGCCATCAGGGAGGGAGG - Intronic
1141602229 16:85133817-85133839 GTGGGGGCCGGGAGTGCAGACGG + Intergenic
1141679709 16:85536985-85537007 GGTGGGGCCTGCTGGCCGGAAGG - Intergenic
1141693191 16:85607829-85607851 GTGGGGGCCTCAAGGGAAGAAGG - Intergenic
1142011778 16:87718977-87718999 GGGGGCGGCTGCCGGGCGGAGGG - Intronic
1142287522 16:89177466-89177488 GAGGGGGCCTCCAGGGAGGAGGG + Intronic
1142299295 16:89247315-89247337 GTGGGGGCAGGGAGGGCGGCGGG + Intergenic
1142615913 17:1135050-1135072 GTGGGTGCCTGCCAGGCGGGTGG + Intronic
1142705269 17:1689899-1689921 GGGGGCGGCTGCCGGGCGGAGGG + Intergenic
1142719469 17:1766744-1766766 CTGGGGGCCTGGAGGGGTGAGGG + Intronic
1142745677 17:1956428-1956450 GTGGGGGCCTGGTGGGGGGGCGG + Intronic
1143002779 17:3805567-3805589 GTGGGGGACTGCGGGGGTGATGG + Intergenic
1143130241 17:4673001-4673023 GTGGGGCCCTGAAGGGCGATGGG + Exonic
1143177861 17:4966988-4967010 GCGCGGCCCTGCAGGGCGGTGGG - Intronic
1143295718 17:5870441-5870463 GTGGGCGCAGGGAGGGCGGAGGG - Intronic
1143620164 17:8075994-8076016 GAAGGGGCCTGCTGGGCTGAGGG + Intronic
1144727535 17:17509391-17509413 GAGGTGGCCAGCAGGGCAGAGGG + Intronic
1145304965 17:21668960-21668982 CTGGGGGTCTGCAGGGAGGTCGG + Intergenic
1145937929 17:28726112-28726134 GAGGCGGCCTCGAGGGCGGACGG - Exonic
1147006304 17:37406803-37406825 GCGGGGGCCTCCACGGCCGAGGG + Intronic
1147059351 17:37862181-37862203 GGGGGGGCCAGCAGGGGGTAGGG + Intergenic
1147444236 17:40465101-40465123 CTGGGTGGCTGCAGGGCTGAAGG + Intergenic
1147650310 17:42058285-42058307 TTAGGGGCCTGCAGGGCTGGAGG - Intronic
1147660139 17:42112961-42112983 GTGGGGGGCTGCAGGCAGGTAGG + Intergenic
1147709041 17:42449245-42449267 GGGGGCGGCTGCCGGGCGGAGGG - Intergenic
1147722279 17:42546687-42546709 GTGGGGGCCCGCAGGCGGGGCGG + Intergenic
1147723464 17:42552857-42552879 GTGGGGGCCCGCAGGCGGGGCGG + Exonic
1148026340 17:44591560-44591582 AAGGGGACCTGCAGGGCAGAGGG + Intergenic
1148086853 17:44998738-44998760 GTGGGGGCCAGTAAGGCAGAGGG + Intergenic
1148765677 17:50037063-50037085 GTGGGGGCCTGCAAAGGGCAGGG + Intergenic
1150005069 17:61464140-61464162 GTGCGTGCCTGGAGGGAGGAGGG - Intronic
1150441819 17:65197510-65197532 GTGGGGGCATCCAGGATGGATGG - Intronic
1151201016 17:72468082-72468104 GTGCGTGTCTGGAGGGCGGAGGG - Intergenic
1151257607 17:72891097-72891119 GTGGGGGGTGGCAGGGCGGAGGG + Intronic
1151570644 17:74923779-74923801 GCGGGGGCGGGCAGGGCGGTGGG + Intergenic
1151690975 17:75685139-75685161 GTTGGGGCTTGCACGGCTGATGG - Intronic
1151749329 17:76027692-76027714 GTGGGGGCCTGCCTGGCAGCAGG - Intergenic
1151894867 17:76973227-76973249 GTGGGGGCCTGTATGTGGGATGG - Intergenic
1151967649 17:77439787-77439809 GCGGGGGCCTGCAGAGGCGAAGG - Intronic
1151974485 17:77476560-77476582 GTGGACGCCTGCGGGGAGGAGGG + Intronic
1152108040 17:78342086-78342108 GTCGGGGCCGGCGGGGCTGATGG + Intergenic
1152478997 17:80537581-80537603 CGGGGTGGCTGCAGGGCGGAGGG + Intergenic
1152504713 17:80741275-80741297 GTGGGGGCCTTCCGAGTGGAGGG + Intronic
1152575105 17:81136489-81136511 GTGGGGTCCTGGAGGTGGGAAGG - Intronic
1152730637 17:81967951-81967973 GTGGGGACCAGCAGGCTGGACGG - Intergenic
1152738326 17:82008228-82008250 GTGGGAGACTGCAGGGTAGACGG + Intronic
1152748557 17:82052106-82052128 GTCGGGGGCTGCAGGGCCGAGGG + Exonic
1152758975 17:82098503-82098525 GTCGGGGCCCGCGGGGCGGGAGG - Intergenic
1152942930 17:83181956-83181978 CTGGGGGGGTGCAGGGGGGATGG + Intergenic
1154344804 18:13532849-13532871 TTGGGAGCCTGGAGGACGGAAGG - Intronic
1154475334 18:14748830-14748852 GGGGCGCCCTGCAGGGCAGAGGG + Intronic
1154501753 18:15000916-15000938 CTGGGGGTGGGCAGGGCGGAGGG + Intergenic
1154529399 18:15329856-15329878 GGGGCGCCCTGCAGGGCGGAGGG - Intergenic
1155205587 18:23555282-23555304 GTGGTGGCCAGCAGGCCAGAGGG + Intronic
1155286459 18:24293720-24293742 GTGGGGGGCTGAGGGGTGGAAGG + Intronic
1156489056 18:37485673-37485695 GCGGGAGCCTGGAGGGCGGGCGG - Intronic
1156651964 18:39235594-39235616 GGGGGGCCGTGCAGGGAGGAAGG - Intergenic
1157095169 18:44680443-44680465 GCGGGGGCCCGCGGCGCGGAGGG - Intronic
1158030684 18:52961127-52961149 GTGGGGGCCTGTTGTGCGGTGGG + Intronic
1159480858 18:68989613-68989635 CAGGGGGCCTGCGGGGAGGAAGG + Intronic
1160387539 18:78505619-78505641 TTGGGGGCCAGGAGGGAGGAAGG - Intergenic
1160589766 18:79936979-79937001 GTGGGGTCCTTGAGGGCAGAAGG + Intronic
1160767524 19:815074-815096 GTGGACACCTGCAGGGCGGAAGG + Exonic
1160812615 19:1019490-1019512 CTGGGGGGCTGCAGGGAGGAAGG + Intronic
1160874840 19:1292155-1292177 GGTGGCGCCTGCAGGGGGGAGGG - Intronic
1161063715 19:2227554-2227576 GCGGGGGGCCGGAGGGCGGAGGG + Intronic
1161112730 19:2479098-2479120 CTTGGGGGCTGCAGGGCAGAGGG - Intergenic
1161129843 19:2581329-2581351 GTGGGGGGGTGGGGGGCGGAGGG + Intronic
1161297220 19:3526198-3526220 GTGGGGGCCTGCAGGGCGGATGG - Intronic
1161319907 19:3636371-3636393 GTGGGGGCCAGAAGGGAGGCAGG - Intronic
1161705522 19:5819069-5819091 GTGTGGGCAAGCAGGGTGGAGGG + Intergenic
1162538185 19:11276732-11276754 GGGGGCGGCTGCCGGGCGGAGGG + Intergenic
1162562731 19:11426841-11426863 GGTGAGGCCTGCAGGGCAGAGGG - Intronic
1162954627 19:14091085-14091107 GAGGGGGCGGGCAGGGCGGGCGG + Intergenic
1163027041 19:14518470-14518492 GCGGGGGCGGGCGGGGCGGAAGG - Intronic
1163102747 19:15107808-15107830 CTGAGGGCCTGGAGGGTGGAGGG + Intronic
1163186246 19:15641400-15641422 GTGGCATCCTGCAGGGCAGATGG - Exonic
1163593215 19:18205610-18205632 GTGGGGGGCTCCAGGGCAGCTGG + Intergenic
1163760250 19:19132602-19132624 GTGGAGACCTTCAGGGCTGAGGG + Intronic
1164125934 19:22317549-22317571 GTGGGGGGCTGCGGGAGGGATGG - Intergenic
1164642479 19:29836533-29836555 GTTGGGGCCTGCAGGTCAGGTGG + Intergenic
1165149863 19:33753976-33753998 GTGGGGGGATGGAGGGGGGATGG - Intronic
1165149881 19:33754016-33754038 GTGGGGGGATGGAGGGGGGATGG - Intronic
1165351527 19:35278530-35278552 GTGGGGGCCGGCTGGGCTCAGGG + Intronic
1165362509 19:35345612-35345634 GTGGGGGCCTTCAGAGAGGGGGG - Exonic
1165462361 19:35951613-35951635 GTGGGGCCATGGAGGGTGGAGGG + Intergenic
1166198909 19:41223603-41223625 CTGGGGGTCTCCAGGGTGGAGGG + Intronic
1166230368 19:41422931-41422953 GTGGGGGTCAGGAGGGAGGATGG - Intronic
1166555912 19:43699791-43699813 GAGGGGGCCTCCCGGGCGGCGGG - Intergenic
1166888248 19:45973935-45973957 GTGGGGGCCCGGGGGGCGGCGGG + Intergenic
1167148212 19:47694942-47694964 GTGGAGGTCTGCGGGGCGGCAGG - Exonic
1167217074 19:48171779-48171801 CTGGGGGCCTGCGTGGAGGAGGG - Exonic
1167265368 19:48480458-48480480 GCGGGGGCCTTCAGGCCGGCAGG - Intronic
1167509414 19:49888326-49888348 GCGGGGCGCTGCGGGGCGGACGG - Intronic
1167635933 19:50655776-50655798 GTGGGAGCCTGCAAGGCAGGAGG - Intronic
1167643527 19:50694557-50694579 TAGGGGGCCTGCTGGGAGGAAGG + Intronic
1167665491 19:50820961-50820983 GTGGGGGCAGGTAGGGAGGAGGG + Intronic
1168277889 19:55287134-55287156 GGGGGGGCCTCCGGGGCTGAGGG + Intronic
1168296489 19:55379504-55379526 ATGGGGGCATGCAGGGATGAAGG - Intronic
1168312144 19:55465662-55465684 GTGGGGGCCAGCAGGCAGGTGGG + Intergenic
925068952 2:951141-951163 GAGGGGGCGTGGAGGGAGGAGGG - Intronic
925451090 2:3969696-3969718 GTGGGGGGCAGCAGGGCAGAGGG - Intergenic
925905963 2:8539806-8539828 CTGGGGCCCTGCAGCGAGGACGG - Intergenic
927184520 2:20472833-20472855 CTGGGAGCCTGCAGGGTGGTAGG + Intergenic
927712109 2:25332434-25332456 GTGGGGTCTGGCAGGGCGGAAGG - Intronic
927826433 2:26312901-26312923 GTGGGGGCCAGCTGGGCAGTCGG - Intronic
927990482 2:27443497-27443519 GTTGGGCCCTGCAGGAAGGACGG + Exonic
928167571 2:28981927-28981949 GTGGGGGCATGCTGTGGGGATGG + Intronic
928722176 2:34133203-34133225 CTGGGCGGCTGCCGGGCGGAGGG + Intergenic
929065061 2:37964138-37964160 CGGGGCGCCTGCCGGGCGGAGGG + Intronic
929170397 2:38926685-38926707 CTGGGGTTCTGCAGGGAGGAAGG + Intronic
929668619 2:43852487-43852509 GTGAGGGCCTGGGGGGCAGATGG + Intronic
929776388 2:44933535-44933557 CTGGGAGACTGCATGGCGGAGGG - Intergenic
929789694 2:45013764-45013786 GTGAAGGCCTGGAGGGCAGAGGG - Intergenic
932048636 2:68376901-68376923 GTGGGGGACTGCAGGGAGGTGGG - Intronic
932337083 2:70937656-70937678 CCGGGTGCCTGCAGGGAGGAGGG - Intronic
932422268 2:71608240-71608262 GAGGGAGCCTGCAGAGAGGAGGG + Intronic
932816342 2:74865170-74865192 GAGGAGGGCTGCAGGGAGGAGGG + Intronic
934663935 2:96157474-96157496 ATGGGGGCCTCCTGGGGGGACGG - Intergenic
934771649 2:96911450-96911472 GTGGAAGCCTGCAGGGAGCAGGG + Intronic
935203667 2:100879885-100879907 CTGGTGGCCTGCACGGCTGAGGG + Intronic
936514576 2:113173776-113173798 GTGGGGGCCTCCAAGGAGCAGGG + Intronic
937825599 2:126365442-126365464 GTGAGGGCATGCAGGGTGTAAGG + Intergenic
937952968 2:127402367-127402389 GTGGAGGCCTGCAGGCCTGCAGG - Intergenic
937981638 2:127619338-127619360 GTGGGGGCCGGCTGGGTGGTGGG + Intronic
938080447 2:128367303-128367325 GAGGGGGGCTGCAGCGAGGAGGG - Intergenic
938386227 2:130869223-130869245 GTGGAGGCCTGCAGAGTGGTTGG + Intronic
938528496 2:132161276-132161298 AGGGCGCCCTGCAGGGCGGAGGG - Intronic
941025131 2:160449126-160449148 GGGGGCGGCTGCCGGGCGGAGGG - Intronic
946190062 2:218003284-218003306 GCGGGGGTCTGCAGTGAGGAGGG - Intergenic
946402649 2:219476730-219476752 GTGGTGGCTTGCAGGGAGGCGGG + Intronic
947854206 2:233312279-233312301 GAGGGGGACTGCAGAGTGGACGG - Intronic
947888317 2:233594020-233594042 GTGGGGGCCTGCAGGCCACAGGG - Intergenic
947894537 2:233657143-233657165 GTGGGGGCCAGCAGGCCACAGGG - Intronic
948824323 2:240566989-240567011 GTGGGGCCCTGCAGTGCCAAGGG - Intronic
948963317 2:241356609-241356631 GTGGGGGCAGGCGGGGCGGTGGG + Intronic
948963360 2:241356744-241356766 GTGGAGGCCGGCAGGGCCGTGGG + Intronic
1168891327 20:1296894-1296916 ATGGGGGCCGGCAGGGCTGCAGG - Intronic
1168998814 20:2151878-2151900 TTGGGTGCCTGCAGGGTAGAGGG + Intronic
1171456127 20:25273360-25273382 GGAGGGGCCTGCTGTGCGGAGGG + Intronic
1171486656 20:25490725-25490747 GTGGGGGACTGCAGTGAGAAGGG + Intronic
1171522482 20:25786431-25786453 CTGGGGGCCTGCAGGGAGGTCGG + Intronic
1171530230 20:25848393-25848415 CTGGGGGCCTGCAGAGAGGTCGG + Intronic
1171554345 20:26069452-26069474 CTGGGGGCCTGCAGGGAGGTCGG - Intergenic
1172103194 20:32498058-32498080 GTGGAGGTCTGCAGCCCGGAAGG + Intronic
1172814083 20:37672552-37672574 GTGGGGGGCTACAGGGCAGAAGG + Intergenic
1172946447 20:38693177-38693199 CTGGGGGCCTGCTGGGAGGAGGG - Intergenic
1172973272 20:38888669-38888691 GAAGGGGCCTGCAGGGCTGGTGG + Intronic
1173191046 20:40875778-40875800 GTTGGGGCCTGGAGGCCTGATGG - Intergenic
1173983312 20:47241544-47241566 GTGAGGGCAGGCAGGGAGGAGGG + Intronic
1174084170 20:47993521-47993543 GTGAGGTCCTGCAGGGAGGCTGG + Intergenic
1174339384 20:49886579-49886601 CTGGGAGCCTGCAGGGAGGCAGG - Intronic
1174404581 20:50294965-50294987 ATGGGGGGCAGGAGGGCGGAGGG + Intergenic
1174804492 20:53593862-53593884 GAGGGGGCGGGGAGGGCGGAGGG + Intronic
1175247026 20:57588491-57588513 GGGGGGGCCTGCAGGGTGGTGGG - Intergenic
1175769894 20:61616920-61616942 ATGGGGGGCTGCTGGGTGGAGGG + Intronic
1175815592 20:61881678-61881700 GTGGGGGACTGCAGGTGGGGAGG + Intronic
1176081054 20:63273147-63273169 GCGGGGGGCGGCACGGCGGAGGG - Intronic
1176090242 20:63315413-63315435 GAGGGAGCCGTCAGGGCGGAGGG - Exonic
1176123876 20:63466489-63466511 GTGGAGGCCAGGAGGGAGGATGG - Intronic
1176267026 20:64215028-64215050 GCTGGGACCTGCAGGGCTGAAGG - Intronic
1176623520 21:9073806-9073828 GAGGGGGCATTCAGGGCGGTGGG + Intergenic
1176767999 21:13038613-13038635 GGGGAGCCCTGCAGGGCAGAGGG + Intergenic
1177157248 21:17512614-17512636 GTGGGTGCAGGCGGGGCGGAGGG + Exonic
1178618340 21:34153249-34153271 GTGGGGCCCTGTAGGGTTGAGGG - Intergenic
1178685245 21:34705495-34705517 CTGGGAGCCTGAAGGGTGGAAGG - Intronic
1179020119 21:37632107-37632129 GTGGGGGCCGACCGGGGGGAGGG + Intronic
1179603908 21:42499648-42499670 GTGCGGCTCTGCAGGGAGGAGGG + Intronic
1179645376 21:42772092-42772114 GTGGGGGCTGACAGGGGGGAAGG - Intronic
1179881007 21:44293318-44293340 GTGGGGGGCTGCGGGGGGAAGGG + Intronic
1180042707 21:45288255-45288277 CTGGGGGCCGGGAGGGCTGACGG + Intergenic
1180093143 21:45542679-45542701 GTGGGGGCCCGAGGGGCGGTCGG - Intronic
1180109703 21:45642389-45642411 GTGGGGGGCGGCAGGGCAGGAGG - Intergenic
1180170708 21:46056858-46056880 GTCAGGGCCTGCAGGCTGGATGG + Intergenic
1180174761 21:46082205-46082227 CTGGGGCCCTGCACGGTGGACGG - Intergenic
1180432560 22:15264896-15264918 GGGGCGCCCTGCAGGGCGGAGGG + Intergenic
1180954688 22:19736395-19736417 GTGGGGGCCTCGAGGGCAGCTGG + Intergenic
1180991623 22:19940835-19940857 TTGGGGGTCTCCAGGACGGAGGG - Intronic
1181031876 22:20152270-20152292 GTGAGGGGCAGCAGGGCCGATGG - Intergenic
1181042983 22:20201607-20201629 ATGGGGGCCTGCTGGGGGGCTGG + Intergenic
1181164155 22:20974500-20974522 GTGGGTGCCAGGAGGGTGGAGGG - Intronic
1181979171 22:26753760-26753782 GTGGGGGCAGGCAGGGGGTATGG - Intergenic
1182820303 22:33210217-33210239 GTGGAGGCCGGGAGGGCGGCTGG - Intronic
1183185785 22:36290939-36290961 CGGGGCGGCTGCAGGGCGGAGGG - Intronic
1183368049 22:37417562-37417584 GAGGCGGCCTGCAGAGCGGCAGG - Intronic
1183396091 22:37571692-37571714 GTGGGGGCCAGCAGGGGTGTGGG + Intronic
1183467417 22:37986691-37986713 AGGTGGGCCTGCAGGGCGGGTGG + Intronic
1183535517 22:38398544-38398566 GAGGGGGCGGGGAGGGCGGAGGG + Intergenic
1184021904 22:41826641-41826663 GTGGGGGGCTGCAGGGGGACAGG + Intergenic
1184248565 22:43247885-43247907 ATGTGGGCCTGCAGGGCCGGGGG + Intronic
1184596776 22:45518699-45518721 CTGGAGGCCTGCTGTGCGGACGG + Exonic
1184741385 22:46430744-46430766 GTGGGGGCCTGGAGGGGTGGCGG - Intronic
1184881003 22:47304198-47304220 GCGTGGGCCTGCAGGGAGGCTGG - Intergenic
1184929866 22:47672991-47673013 GTGTGGGCCTGCACGGTGCAGGG + Intergenic
1185181875 22:49368413-49368435 GCTGGTGCCTGCAGGGCGGTGGG - Intergenic
1185236422 22:49716217-49716239 CTGGGGGCCCTCAGGGCAGATGG - Intergenic
1185244343 22:49765292-49765314 CTGGGGGGCTGCAGGGCTGGGGG + Intergenic
1185245728 22:49771802-49771824 GTGGGGGCTTGGAGGAGGGAGGG - Intergenic
1185275693 22:49949440-49949462 GTGGGGGCCAGCCGGGAGGGTGG - Intergenic
1185395215 22:50583185-50583207 GTGGGAGCCGGCGGGGCGGCGGG + Intronic
950253753 3:11487847-11487869 GGGGCAGCCTGCCGGGCGGAGGG + Intronic
950740965 3:15051685-15051707 TTGGGGCCCTGCTGGGGGGATGG - Exonic
951080496 3:18445355-18445377 GTGGGGGGCGGCGGGCCGGAGGG + Intronic
952206956 3:31189937-31189959 GCGGGGGCTGGCAGGGAGGAGGG - Intergenic
954389454 3:50260995-50261017 ATGGGGGGCTGCAGGCAGGAAGG + Intergenic
955077129 3:55624424-55624446 GCTGGGGCATGCAGGGTGGATGG + Intronic
956066372 3:65401369-65401391 GTGGGGGGCTGGAGGTGGGAGGG - Intronic
959573091 3:107906578-107906600 GTTAGGGCCTGCTGGGCAGAAGG + Intergenic
960115082 3:113885259-113885281 GTGGGGGCCTCCGGGGCCGGCGG + Intronic
960672198 3:120164944-120164966 GTGGTGGCATGCTGGGAGGAAGG + Intronic
960928755 3:122822954-122822976 GTGGGGAGGTGGAGGGCGGATGG - Intronic
961817171 3:129557037-129557059 ATGGGGGCCTGAAGAGCTGAGGG - Intronic
961909623 3:130301264-130301286 GTGGGGGCTGGGAGGGCAGAGGG + Intergenic
963773729 3:149417069-149417091 GAGGGGAACTGCATGGCGGAGGG + Intergenic
964131962 3:153299266-153299288 GTGGGGGGCTGGTGGGAGGAGGG + Intergenic
964763517 3:160156622-160156644 GTGGGGGACTGTAGGGTGCATGG + Intergenic
965684206 3:171284117-171284139 GAGGGGGGCGGCAGGGAGGAGGG + Intronic
965883410 3:173414108-173414130 GTGGGGGCCTGGAAGGGAGAGGG + Intronic
966775854 3:183542058-183542080 CTGAGGGCCTGCAGGGCAGCCGG - Intronic
967578523 3:191125067-191125089 GGGGGCGGTTGCAGGGCGGAGGG + Intergenic
968534043 4:1112873-1112895 GTGGGGGGCTGCAGGGAGGAAGG - Intronic
968551529 4:1226055-1226077 GGTGGGGCATGGAGGGCGGAAGG - Intronic
968614775 4:1572528-1572550 GGGGGGGCCTGCAGGAGGCACGG + Intergenic
969138727 4:5051420-5051442 GTGGGCGGCGGCAGGGCGGAAGG - Exonic
969436648 4:7192773-7192795 CTGGGCGCCTGCGGGGCGGCGGG + Exonic
969594818 4:8142996-8143018 GAGGGGGCCTGCAGAGGGGAGGG - Intronic
969605780 4:8201611-8201633 GGCTGGGCCTGCAGGGCTGAGGG + Intronic
969724858 4:8912909-8912931 GTGGGGGCTGGCATGGGGGAGGG - Intergenic
969724870 4:8912931-8912953 GTGGGGGCCGGCGTGGGGGACGG - Intergenic
969724927 4:8913068-8913090 GTGGGGGCTGGCATGGGGGAGGG - Intergenic
969738001 4:9003948-9003970 GTGGGGGGGTGGAGGGTGGAGGG + Intergenic
970216095 4:13761288-13761310 GGGGGTGGCTGCCGGGCGGAGGG + Intergenic
973646070 4:52952383-52952405 GCAGGGGCCTGCAGAGAGGAGGG - Intronic
973888442 4:55346300-55346322 GGGGGCGCCAGCAGCGCGGAAGG + Exonic
974021258 4:56693687-56693709 GGGGGCGGCTGCCGGGCGGAGGG + Intergenic
975035681 4:69677320-69677342 GTGAGGGGCTGGAGGGAGGAAGG + Intergenic
976132140 4:81896065-81896087 GTGGGGGGCAGCAGGACAGAGGG - Intronic
976425777 4:84901450-84901472 GTGGGGGCCTGCTTGCTGGAAGG - Intronic
977725036 4:100286735-100286757 GAGGGGGCCTTCAGGCCAGATGG + Intergenic
979689654 4:123547152-123547174 GTTGGGGGCTGGAGGGGGGAGGG - Intergenic
981346862 4:143685867-143685889 GTGGGGGCCTGGAGGAGGGATGG + Intronic
981898742 4:149835976-149835998 TTGGGGGCATGCAGGGCTTAGGG + Intergenic
982075303 4:151731867-151731889 CTGGGTGGCTGCCGGGCGGAGGG - Intronic
984829384 4:183957784-183957806 GTGGTTTCCTTCAGGGCGGATGG + Intronic
985484507 5:140863-140885 GTGGGGGTGTGCAGGGGAGAGGG - Intronic
985484554 5:140990-141012 GTGGGGGTGTGCAGGGGAGAGGG - Intronic
985588177 5:751473-751495 GCGGGGGCATGCAGGGCAGGTGG + Intronic
985588203 5:751543-751565 GTGGGGGCATGCAGGGCAGGTGG + Intronic
985602847 5:843936-843958 GCGGGGGCATGCAGGGCAGGTGG + Intronic
985670698 5:1205162-1205184 GTGGGGCCCTGCAGGGCGCCTGG - Intronic
985769576 5:1800425-1800447 GTTGGGGCCTGCAGGGAGCGCGG - Intronic
986799200 5:11241994-11242016 ATGGGGGCCTCCAGAGAGGACGG + Intronic
988870654 5:35385364-35385386 GTGTAGGCCTGCAGGGAGGCAGG + Intergenic
989379628 5:40800384-40800406 GTGGCGGCCGGCCGGGCGGGGGG - Intergenic
990501094 5:56397899-56397921 CGGGGTGGCTGCAGGGCGGAGGG + Intergenic
992024073 5:72653687-72653709 GGGAGGCCCTGCAGGGCAGAAGG + Intergenic
992470116 5:77043783-77043805 GTGGGCAGCTGCCGGGCGGAGGG + Intronic
994768979 5:103957088-103957110 GTGGGAGCCTGAAGGGCTGTTGG + Intergenic
995236210 5:109832834-109832856 GGGGGCGGCTGCCGGGCGGAGGG + Intronic
995769231 5:115651758-115651780 ATGGGGGAATGGAGGGCGGAAGG - Intergenic
997624808 5:135324452-135324474 GGGGTGGCCTGCAGGGGTGAGGG + Intronic
998170833 5:139871141-139871163 ATGGGGTCCTGTAGGGCAGAAGG + Intronic
998821167 5:146059287-146059309 GTCGGGGGCTGCAGGGAGAAAGG - Intronic
999389632 5:151180709-151180731 GAGGGGTCCTGCAGTGCAGAAGG + Intergenic
1001933145 5:175687180-175687202 TTGAGGGCATGGAGGGCGGAGGG + Intergenic
1001948226 5:175797488-175797510 GTGGGGGTCTGGAGGGAAGACGG - Intronic
1002089455 5:176795934-176795956 GTAGGGGCCGGAAGGGCTGATGG - Intergenic
1002444423 5:179280378-179280400 CTGGGGGCCTGCAAGGGGGCAGG - Intronic
1002449286 5:179309910-179309932 GTGGGGGCCTGCTGGGTCCAGGG - Intronic
1002584332 5:180232571-180232593 GTGGGGGTTTTCAGGGAGGAGGG - Intergenic
1002770500 6:286786-286808 GTAGGGGGCTGCAGGGAGCAGGG - Intergenic
1004722168 6:18277311-18277333 GAGGGCGCCCGCGGGGCGGAGGG + Intergenic
1005450047 6:25963379-25963401 GTGGGGGCGGGCGGGGGGGAGGG + Intronic
1005824991 6:29627434-29627456 GTGGGGGCTTGCGGGGCAGGGGG - Intronic
1006225375 6:32532336-32532358 CGGGGCGGCTGCAGGGCGGAGGG - Intergenic
1006253078 6:32807255-32807277 GTGGATGCCTGCAGGGAGGTGGG - Intergenic
1006919641 6:37619040-37619062 GTGGAGTGCTGCAGGGCAGAGGG + Intergenic
1006920849 6:37626178-37626200 AGGAGGGCCTGCAGGGAGGAGGG - Intergenic
1007246993 6:40470132-40470154 GTGGGGTTCTGCAGGCAGGATGG - Intronic
1010300644 6:74255249-74255271 TTGGGCGGCTGCTGGGCGGAGGG + Intergenic
1012428698 6:99142169-99142191 GGGGGTGGCTGCCGGGCGGAGGG - Intergenic
1013954995 6:115831498-115831520 CTGTGGGCCTGCAGGGCTGATGG - Intergenic
1016967139 6:149729414-149729436 GTGGGTGACTGGAAGGCGGAAGG + Intronic
1017202026 6:151764490-151764512 GTGGGGGGCTGCTGAGCGCAGGG + Intronic
1017653226 6:156601843-156601865 GTGGGGGCCTGCAGGGCTGTAGG - Intergenic
1017743504 6:157427109-157427131 AAGAGGGCGTGCAGGGCGGAGGG + Intronic
1017981909 6:159407452-159407474 GGGGGCGGCTGCCGGGCGGAGGG - Intergenic
1018230126 6:161667262-161667284 GGTGGGGGCTGCAGGGTGGAGGG - Intronic
1018429622 6:163713099-163713121 CTGGGGGCCTGCAGGGAGCCAGG + Intergenic
1018711154 6:166498980-166499002 GTGGGGTGTTGCAGGGCAGAGGG + Intronic
1018767353 6:166944854-166944876 GTGTGGGCCTGGTGGGCAGAGGG - Intronic
1019000337 6:168744240-168744262 GTGGGGGGCTGAAGGGCTGAAGG + Intergenic
1019291660 7:253535-253557 GTGGGGGCTTTCTGGGAGGAAGG - Intronic
1019417616 7:934618-934640 GCTGGGGGCTGCAGGTCGGATGG - Intronic
1019513267 7:1429010-1429032 GGCGGGGTCTGCAGGGCCGAGGG + Intronic
1019562608 7:1665990-1666012 GGAGGGGCCGGCAGGGCGGGAGG + Intergenic
1019594811 7:1853629-1853651 GTGTGGGTGTGCAGGGCGGCGGG - Intronic
1020112355 7:5454746-5454768 ATGGGGCCCTGCAGGCTGGAGGG - Intronic
1022089334 7:27097246-27097268 GTGGGGGCTGGCAGGTGGGAGGG + Intergenic
1022114184 7:27248281-27248303 GTGGAGGACAGCAGGGAGGAAGG + Intergenic
1022181354 7:27923641-27923663 CTGGGGGGCTGCAGGGGGAATGG - Intronic
1022970063 7:35508741-35508763 GTGGGGGCCTGCTGTGGGGTGGG + Intergenic
1023255880 7:38311632-38311654 GTGGGGGTCTGCTGGGCAGCAGG - Intergenic
1023598346 7:41855933-41855955 GTGGGGGCAGGCAGGGATGAAGG - Intergenic
1024748163 7:52431310-52431332 GTGGGCTCCTGCACGGCCGAAGG - Intergenic
1026594589 7:71723842-71723864 CTGGAGGCTGGCAGGGCGGATGG - Intergenic
1026911897 7:74095849-74095871 GTGGGGCCTTGAAGGGCAGATGG - Intronic
1026933599 7:74238851-74238873 GTGGGGGCCAGTGGGGCTGAAGG - Intronic
1028365713 7:90028293-90028315 GTGGGGGGCTGCAGGGGAGGTGG + Intergenic
1029599043 7:101553234-101553256 CTGGGGGCCTGCAGGGAGTCAGG - Intronic
1029737479 7:102472778-102472800 GTGGGGGCCTGCAGGGCTGCCGG - Exonic
1030348161 7:108456045-108456067 TCGGGGGCCTGCAGGGGAGAAGG + Intronic
1031317294 7:120273423-120273445 GTGCGGGGCTGCGGGGCGGCGGG - Intergenic
1031743943 7:125469028-125469050 GTGGTGGGCTGCAGGGCGGGGGG + Intergenic
1031966377 7:128031027-128031049 GTGGGGGCGGGGAGGGCAGAGGG + Exonic
1032061630 7:128729994-128730016 GAGAGGGGCTGCAGGCCGGAGGG - Exonic
1034436357 7:151064511-151064533 GCGGTGGTCTGCAGGGAGGAGGG - Exonic
1034456752 7:151174786-151174808 GTTGGGGCCTGGAGGGCGCGAGG - Intergenic
1034979357 7:155466511-155466533 GGGCAGGCCTGCAGGGCGGCGGG - Intergenic
1035140261 7:156752572-156752594 GAGGGGAGCTGCAGGGAGGAGGG + Intronic
1035486637 7:159231299-159231321 GAGGGGGCCCGCGGGGCGGCGGG + Intergenic
1035701464 8:1642024-1642046 GTGGGGGCCGGCAGGGTCGAGGG - Intronic
1037281850 8:17250056-17250078 GTGAGGGTCTTCAGGGCGGAAGG + Intronic
1037767850 8:21782851-21782873 TCGGGGCCCTGCAGGGAGGAAGG + Exonic
1037857708 8:22383630-22383652 GTGCTGGCCTGCAGGGAGGCTGG + Intronic
1039546957 8:38417305-38417327 CTGGGGGCCTGCACGCAGGATGG - Exonic
1039885422 8:41651440-41651462 GTGGGAGCCTGCTGGGAAGAGGG + Intergenic
1040043507 8:42939686-42939708 CTGGGTGGCTGCTGGGCGGAGGG + Intronic
1040978498 8:53220591-53220613 GTGTGGGGTTGCAAGGCGGATGG + Intergenic
1046736055 8:117777781-117777803 CTGGGTGGCTGCCGGGCGGAGGG - Intergenic
1048847543 8:138615063-138615085 GTGGCGTCCTGCAGGGTGGCTGG - Intronic
1049181253 8:141223689-141223711 GCGGGGGCCTCCTGGGTGGATGG - Intronic
1049232220 8:141490287-141490309 GTGGGAGCAGGCAGGGCGGGAGG + Intergenic
1049380817 8:142314960-142314982 GTGGGGGTCTGCAGGCCAGGTGG - Intronic
1049391889 8:142375887-142375909 GTGGACGCCTGCAGGGTGTAAGG + Intronic
1049436212 8:142587387-142587409 GTGGGGGGCTGCAGAGCGGGAGG + Intergenic
1049436249 8:142587489-142587511 GTGGGGGGCTGCAGAACGGGAGG + Intergenic
1049441771 8:142612872-142612894 GTGGAGCCCTGCAGGGGGGAGGG + Exonic
1049473687 8:142787355-142787377 CTGGGGCCCTGGAGGGCGGGAGG - Intergenic
1049595050 8:143479483-143479505 GCGTGGGCCTGCCGGACGGATGG - Intronic
1049740798 8:144239977-144239999 GTGGGGGGCAGCGGGGCGGCGGG + Intronic
1049850078 8:144826328-144826350 CTGGGGGTCTGGAGGGCGGCTGG + Intergenic
1051936234 9:22446697-22446719 GTGGGGACCTTCTGGGAGGAGGG - Intergenic
1052862895 9:33447647-33447669 GGGCGGGGCTGCAGGGCGGGCGG - Intergenic
1053054063 9:34983552-34983574 GTGGGAGCCTGGTGAGCGGATGG - Intergenic
1053707114 9:40767616-40767638 GGGGCGCCCTGCAGGGTGGAGGG - Intergenic
1054417027 9:64888384-64888406 GGGGCGCCCTGCAGGGTGGAGGG - Intergenic
1056243207 9:84669572-84669594 CTGGGGGCGAGCAGGGAGGAGGG - Intronic
1058976074 9:110126742-110126764 GTGGGGGTCAGCAGCGGGGAGGG - Intronic
1059437084 9:114283525-114283547 GTGGGGAACTCCAGGGAGGAGGG + Intronic
1059467750 9:114479685-114479707 GAGGGGGACTGCAGAGGGGAAGG + Intronic
1060039390 9:120286721-120286743 GTGAGGGCCTGCCTGGCAGAGGG + Intergenic
1060424591 9:123493777-123493799 GTGGAGGCTGCCAGGGCGGAGGG + Intronic
1061062072 9:128255446-128255468 GAGGGCGCCGGCAGGGCGGCTGG + Intergenic
1061244587 9:129394901-129394923 TTGGGGGTCTGCTGGGCAGAGGG - Intergenic
1061275796 9:129568908-129568930 GCGGGGGCCTGGGGGGCGGCGGG - Intergenic
1061369817 9:130191948-130191970 ATGGGGGGCTGGAGGGCAGAAGG + Intronic
1061743171 9:132722115-132722137 GTGGGGGGCTGCGGGGTGGGGGG + Intergenic
1061939020 9:133874201-133874223 GTGGGGGCCTGCAGCCTGCAAGG + Intronic
1062209643 9:135356700-135356722 GTCTGGGCCTGCAGGTGGGAAGG + Intergenic
1062272778 9:135717442-135717464 GTGGGGGGCTGCTGGTCGGCTGG + Intronic
1062341473 9:136095458-136095480 GTGGGGGCCGGCGGGGCGTGGGG + Intergenic
1062448649 9:136606394-136606416 CTGGGCGTCTGCAGGGCGGAGGG - Intergenic
1062457272 9:136645660-136645682 GTGGGGGCCTGCAGGGGCTCTGG + Intergenic
1062476969 9:136733060-136733082 GTGGAGCCCTGCAGGGCTGCTGG + Intergenic
1062498736 9:136843432-136843454 CTGGGGGTGGGCAGGGCGGAGGG - Intronic
1062541116 9:137041979-137042001 GTGGGGGCCTGGAGGGCTTCTGG + Intronic
1062567758 9:137170829-137170851 GTGAGGGCCTGCAGGGAGGACGG + Intronic
1062601157 9:137319143-137319165 GTGGGCAGCTCCAGGGCGGAGGG + Intronic
1203746704 Un_GL000218v1:44234-44256 GAGGGGGCATTCAGGGCGGCGGG + Intergenic
1203563398 Un_KI270744v1:75246-75268 GAGGGGGCATTCAGGGCGGCAGG - Intergenic
1186645798 X:11506107-11506129 GTGGGAGACTTCAGGGAGGAGGG - Intronic
1187088503 X:16067728-16067750 GTGGGGGCCTGGGGGAGGGATGG + Intergenic
1187344360 X:18449491-18449513 CTGGGGGGCGGCAGGGGGGAAGG - Intronic
1187963521 X:24588284-24588306 GAGGGGGCCTACAGTGAGGAAGG - Intronic
1188117570 X:26263835-26263857 ATGGGAGCCAGAAGGGCGGATGG + Intergenic
1188977626 X:36694055-36694077 GTGGGGGCCTGGCGGGAGGTGGG + Intergenic
1189381423 X:40505208-40505230 GTGGGGGCCTGGAGGGCTGTGGG + Intergenic
1190241379 X:48659771-48659793 CTGGGCGGCTGCCGGGCGGAGGG + Intergenic
1190274613 X:48891848-48891870 GTGAAGGCCTGCAGGGGGCAGGG + Intergenic
1190482872 X:50894850-50894872 GTGGGGGCTGGCAGGGAGGCAGG + Intergenic
1190701110 X:52990430-52990452 GTGGGTGACAGCAGGGCTGAGGG + Intronic
1192118270 X:68432151-68432173 GTTGGGGGCTGCTGGGCTGAAGG - Intronic
1192156943 X:68753692-68753714 CTGGGGGCCTGCAAGGAGGAGGG + Intergenic
1192252136 X:69422148-69422170 CTGGGTGGCTGCTGGGCGGAGGG - Intergenic
1192382865 X:70636145-70636167 GTGGGGGCCAGCCTGGGGGATGG - Intronic
1194181192 X:90713821-90713843 CGGGGCGGCTGCAGGGCGGAGGG - Intergenic
1195081084 X:101371554-101371576 GTGGTGGGGTGCAGGGCAGAGGG - Intronic
1196683923 X:118495313-118495335 CTGGGGGCTTGCGGGGTGGAGGG + Intergenic
1198310593 X:135423998-135424020 GTGGGGGCCTGCAGGCCCAGGGG - Intergenic
1198369182 X:135974217-135974239 GGCGGGGCCTGCGGGGAGGATGG + Intergenic
1199017056 X:142830449-142830471 GTGGGGGGCGGGGGGGCGGAGGG - Intergenic
1200142982 X:153910899-153910921 GTGGGGACGGGCAGGGCGGGCGG - Intronic
1200527820 Y:4295750-4295772 CGGGGCGGCTGCAGGGCGGAGGG - Intergenic
1200952911 Y:8918175-8918197 CTGGGCGGCTGCCGGGCGGAGGG + Intergenic
1201160033 Y:11159248-11159270 GAGGGGGCATTCAGGGCGGCGGG + Intergenic
1201742373 Y:17337613-17337635 CTGGGGGTCAGCAGGGCTGAAGG + Intergenic
1202604639 Y:26628338-26628360 GCTGGGGCCTGCAGGGCCGCGGG + Intergenic