ID: 1161298482

View in Genome Browser
Species Human (GRCh38)
Location 19:3531709-3531731
Sequence CACCGCCACCAGGTTCCCCT AGG (reversed)
Strand -
Crispr in exon? Yes
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 194
Summary {0: 1, 1: 0, 2: 0, 3: 10, 4: 183}

Found 6 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1161298482_1161298489 8 Left 1161298482 19:3531709-3531731 CCTAGGGGAACCTGGTGGCGGTG 0: 1
1: 0
2: 0
3: 10
4: 183
Right 1161298489 19:3531740-3531762 CAAGGGCTTCGTGCAGATCTGGG 0: 1
1: 0
2: 1
3: 7
4: 117
1161298482_1161298490 21 Left 1161298482 19:3531709-3531731 CCTAGGGGAACCTGGTGGCGGTG 0: 1
1: 0
2: 0
3: 10
4: 183
Right 1161298490 19:3531753-3531775 CAGATCTGGGACGCAGCCGCAGG 0: 1
1: 0
2: 2
3: 20
4: 148
1161298482_1161298486 -10 Left 1161298482 19:3531709-3531731 CCTAGGGGAACCTGGTGGCGGTG 0: 1
1: 0
2: 0
3: 10
4: 183
Right 1161298486 19:3531722-3531744 GGTGGCGGTGGGCACACACAAGG 0: 1
1: 0
2: 2
3: 21
4: 236
1161298482_1161298487 -9 Left 1161298482 19:3531709-3531731 CCTAGGGGAACCTGGTGGCGGTG 0: 1
1: 0
2: 0
3: 10
4: 183
Right 1161298487 19:3531723-3531745 GTGGCGGTGGGCACACACAAGGG 0: 1
1: 0
2: 0
3: 7
4: 133
1161298482_1161298488 7 Left 1161298482 19:3531709-3531731 CCTAGGGGAACCTGGTGGCGGTG 0: 1
1: 0
2: 0
3: 10
4: 183
Right 1161298488 19:3531739-3531761 ACAAGGGCTTCGTGCAGATCTGG 0: 1
1: 0
2: 0
3: 6
4: 77
1161298482_1161298491 22 Left 1161298482 19:3531709-3531731 CCTAGGGGAACCTGGTGGCGGTG 0: 1
1: 0
2: 0
3: 10
4: 183
Right 1161298491 19:3531754-3531776 AGATCTGGGACGCAGCCGCAGGG 0: 1
1: 0
2: 0
3: 9
4: 110

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1161298482 Original CRISPR CACCGCCACCAGGTTCCCCT AGG (reversed) Exonic
900114426 1:1022424-1022446 CACCTCCTCCAGGTTCCGCAGGG - Exonic
900868111 1:5283063-5283085 CACCGACACCAGGCCCCTCTCGG - Intergenic
901056885 1:6452516-6452538 CACCCCCACCAGCTTGTCCTTGG + Intronic
901153774 1:7122106-7122128 CAGTACCACCAGCTTCCCCTCGG - Intronic
901534773 1:9875088-9875110 CACCCCCAGCAGGTTCTCCCAGG + Intronic
901631652 1:10651038-10651060 CACCCCAGCCAGGTTCCCCCCGG - Exonic
901860695 1:12072608-12072630 CCCACCCAGCAGGTTCCCCTTGG + Intronic
903165856 1:21519930-21519952 CACTGACCTCAGGTTCCCCTAGG - Intronic
903278092 1:22234104-22234126 CTCCCCCACCAGTTTCCCCAGGG + Intergenic
903655821 1:24948248-24948270 CCACGCCACCAGGTGGCCCTTGG + Intronic
903682978 1:25109414-25109436 CACCACCACCAGGTATGCCTAGG + Intergenic
903983512 1:27207177-27207199 CACAGCCAACAGTTTCCCTTGGG + Intergenic
904676143 1:32200468-32200490 CACAACCAACAGGGTCCCCTAGG + Exonic
905518771 1:38581505-38581527 CACCCACACCAGGTTCCCACAGG + Intergenic
907381079 1:54089846-54089868 CACCTTCACCATGTTCCTCTTGG + Intronic
907417874 1:54326951-54326973 CACCACCACCACCTTCTCCTTGG - Intronic
907518682 1:55009218-55009240 CTCCTCCACCAGGATGCCCTTGG + Exonic
907541069 1:55215604-55215626 CGCCGGCAACAGGTTCCCCCGGG + Intergenic
915129315 1:153686118-153686140 CACAGCCACGAGGTTGCCCTGGG - Exonic
915368129 1:155326717-155326739 CACCACCACCACCTGCCCCTGGG + Exonic
915657177 1:157370845-157370867 CACTGCCACCAGGTGCAACTTGG + Intergenic
915671820 1:157495544-157495566 CACCGCCACCAGGTGCAACTTGG - Intergenic
916246853 1:162696815-162696837 CCCAGCCACCAGCTTCCCCTGGG + Intronic
919397008 1:197063398-197063420 CACTGCCACCAGGAGCTCCTGGG + Intronic
921095871 1:211886935-211886957 CACCACCACCATGTTCCACATGG + Intergenic
923750093 1:236739513-236739535 CACCGACACCATCTTGCCCTCGG - Exonic
1063508839 10:6626962-6626984 CACTGTCACCAAGCTCCCCTAGG + Intergenic
1064230998 10:13529092-13529114 CTCCGCCAGCAGGTGGCCCTGGG - Intergenic
1066061298 10:31725681-31725703 CTTGGCCTCCAGGTTCCCCTTGG - Intergenic
1067133163 10:43584570-43584592 CAACTCCACCTTGTTCCCCTGGG - Intergenic
1069651879 10:70054435-70054457 CACAGACCCCAGGATCCCCTAGG + Intronic
1072223779 10:93349323-93349345 CCCCACCTCCAGGTGCCCCTGGG - Intronic
1076677470 10:132154610-132154632 CACCACCAAGAGGTTCACCTCGG + Intronic
1080819091 11:35788093-35788115 TAGAGCCACCAAGTTCCCCTTGG + Intronic
1081611384 11:44565391-44565413 CCCCGCCCCCAGGTTACACTGGG - Intronic
1083610711 11:64002896-64002918 CACCTCCACCAGGTAGCCCCAGG - Intronic
1083615392 11:64023648-64023670 CATCCCCACTAGATTCCCCTGGG + Intronic
1083742889 11:64720500-64720522 CACCTACACCTGGTTTCCCTGGG - Intronic
1084043863 11:66557910-66557932 CACCGAGACCAGCTTGCCCTCGG - Exonic
1090068050 11:123519941-123519963 CACAGCTTCCAGGTTTCCCTTGG + Intergenic
1090451594 11:126811065-126811087 CAGGGCCACCAGGTGCCCATGGG - Intronic
1090709716 11:129374133-129374155 CGCGGCCACCAGGGCCCCCTGGG + Intergenic
1095983687 12:47986362-47986384 CAACGCCACCAGGCTCTCCACGG + Exonic
1101851946 12:108410328-108410350 CACAGCCACCTGGTTCCCCAGGG + Intergenic
1102317995 12:111905349-111905371 CACCGCCACCATGGGCCCATGGG - Intergenic
1102809862 12:115814901-115814923 CCCCTCCACCAGGATGCCCTTGG + Intergenic
1103904267 12:124319462-124319484 CACCCCCACCAGAAACCCCTGGG + Intergenic
1107705042 13:43094317-43094339 CACTGTCAGCAGCTTCCCCTGGG + Intronic
1112349736 13:98622918-98622940 CTCCTTCACCAGTTTCCCCTGGG + Intergenic
1113986918 13:114324783-114324805 CAGGGCCACCTGGGTCCCCTAGG + Exonic
1118490856 14:66258206-66258228 CAGCACCACCAGTTTCCCCTGGG - Intergenic
1122540971 14:102497463-102497485 CACCTCCACCAGGGTCCCTGCGG - Intronic
1122723170 14:103733548-103733570 CAAAGCCCCCACGTTCCCCTTGG - Exonic
1123065709 14:105618210-105618232 CGCCTGGACCAGGTTCCCCTAGG - Intergenic
1123069872 14:105637455-105637477 CGCCTGGACCAGGTTCCCCTGGG - Intergenic
1123089106 14:105734243-105734265 CGCCTGGACCAGGTTCCCCTGGG - Intergenic
1123094893 14:105762400-105762422 CGCCTGGACCAGGTTCCCCTGGG - Intergenic
1127868307 15:63048930-63048952 CAACACCACCCGTTTCCCCTGGG - Intronic
1129481172 15:75827690-75827712 CACCCCCAGCACGCTCCCCTGGG - Intergenic
1130106818 15:80935007-80935029 CACCGCCTCCAGTCTCCACTGGG - Intronic
1132312973 15:100870535-100870557 GACCTCCACCAGGTACCCCAGGG + Intergenic
1132469193 16:92479-92501 CACTGCCACCTGCTTCTCCTTGG - Intronic
1132934392 16:2473561-2473583 CTCCTCCGCCAGCTTCCCCTTGG + Intronic
1133689013 16:8195084-8195106 CACTGACACAAGGTTCACCTGGG - Intergenic
1134052381 16:11145952-11145974 CACCCCCGCCATGGTCCCCTTGG + Intronic
1134077116 16:11299801-11299823 TACTTTCACCAGGTTCCCCTGGG - Intronic
1136127142 16:28192355-28192377 CATCCCCTCCAGGTTCCACTCGG + Intronic
1141694927 16:85614621-85614643 CACCGCCAGCACGCTGCCCTCGG - Intronic
1142006569 16:87692164-87692186 CACCAGCACCAGGTACCCCAGGG - Intronic
1144783919 17:17821522-17821544 CACCCCCAGCAGGATCCTCTGGG + Intronic
1146894875 17:36534272-36534294 CTCCGCCCCCAGGTTCCCGGCGG + Intronic
1147155148 17:38540949-38540971 CACCGCCACCAGCCTCCCTGTGG - Intronic
1149563974 17:57628712-57628734 CTCCCCCACCAGTGTCCCCTGGG + Intronic
1149811699 17:59680509-59680531 CACCCCCACAACCTTCCCCTAGG - Intronic
1149865736 17:60150106-60150128 CTCCGGCCCCAGGTGCCCCTCGG + Intronic
1152361455 17:79835009-79835031 CACCGCCCCCAGGTAGCCTTTGG + Exonic
1152715528 17:81898703-81898725 CACTGCCACCAGAGTCCCCTGGG - Intronic
1152913015 17:83016387-83016409 CAGCCCCACTAGGTTCCTCTCGG - Intronic
1153565696 18:6415019-6415041 CAGCGCCACCCGGCTCCCCGGGG - Intronic
1156371215 18:36473107-36473129 CAGCACCACCAGCTTCTCCTGGG + Intronic
1160972427 19:1775539-1775561 CACCCCCTCCAGGTGCCCCCTGG - Exonic
1161018091 19:1993299-1993321 CACCCACATCAGGTTCCCCGAGG + Intronic
1161038829 19:2099362-2099384 CTCCGCCCCCACGTTGCCCTGGG - Exonic
1161238926 19:3211171-3211193 CCCCCCCACCAGGGTCCCCTAGG + Intergenic
1161298482 19:3531709-3531731 CACCGCCACCAGGTTCCCCTAGG - Exonic
1161713755 19:5864138-5864160 CTCCACCACCAGGTCCCCCATGG + Intergenic
1161713975 19:5865252-5865274 TTCCACCACCAGGTTCCCCTTGG + Intergenic
1163394145 19:17049232-17049254 CACCTCCACCAGGGAACCCTGGG - Intergenic
1164405056 19:27937022-27937044 CACTGTCCCCAGGGTCCCCTGGG + Intergenic
1165323151 19:35098748-35098770 CAGCGCCACCAGGGTCCCGCCGG - Intergenic
1168322168 19:55517212-55517234 CTCCTCCTCCAGGTTCCCCGAGG + Exonic
1168566460 19:57428513-57428535 CACTGCCACCTGGAACCCCTGGG + Exonic
925184736 2:1839288-1839310 CAGCGCCTCCGGGTGCCCCTTGG - Exonic
925388739 2:3481740-3481762 CAGCAGCACCAGGTTCTCCTGGG + Intronic
925686268 2:6476787-6476809 CAGGCCCACCTGGTTCCCCTGGG - Intergenic
925880386 2:8347211-8347233 CACAGCCACCACATGCCCCTGGG - Intergenic
926061684 2:9808619-9808641 CAACGTCACCTGTTTCCCCTTGG + Intergenic
927552297 2:24010606-24010628 CCCAGGCACCAGGCTCCCCTTGG + Intronic
927988197 2:27428557-27428579 CACCGCCGGCAGGTTTCCATTGG - Exonic
928088122 2:28358366-28358388 CACCTGCACCAGGTTCTCATGGG - Intergenic
929000974 2:37346232-37346254 CACTACCACCAGGTTCCCTGTGG - Intronic
932053963 2:68425952-68425974 CACCACCAGCAGCATCCCCTGGG + Intergenic
932597886 2:73105555-73105577 CACTGCCACCAGATACCTCTCGG - Intronic
934743032 2:96739739-96739761 CACCGCCAGCAGTTTCCTCCGGG + Intronic
934863118 2:97780908-97780930 CTCTGCCACCAGGTTCACCTTGG - Intronic
935380543 2:102447097-102447119 CACGGCCACCAGGGTCCCGATGG - Exonic
937636138 2:124157211-124157233 CACAGCCACCCTCTTCCCCTGGG + Intronic
938070834 2:128307340-128307362 CACCACCAGCAGGGTCCCATGGG + Intronic
942318252 2:174713701-174713723 CATCTCCACCAGGTTCCTGTCGG + Intergenic
944414315 2:199467764-199467786 CACCACCACCACGTTGGCCTAGG + Intronic
946253854 2:218429608-218429630 CCTCACCACCAGATTCCCCTCGG - Exonic
949062224 2:241968003-241968025 CATCACCTCCAGGGTCCCCTGGG - Intergenic
1171139537 20:22729001-22729023 CACCACCACCAGGCAACCCTTGG - Intergenic
1172240960 20:33412285-33412307 CATCGCCACCAGGTACCCACAGG - Exonic
1173416006 20:42856587-42856609 CAACACCCCCAGGTTCCCCCAGG + Intronic
1173488465 20:43458538-43458560 CCCCGCCCCCAGGGTCCCCAAGG - Intronic
1175930541 20:62491867-62491889 CACCCCCACCAGGCTCCCAGGGG + Intergenic
1176144732 20:63560488-63560510 CACCTCCTCCAGGTTGGCCTTGG + Exonic
1176289076 21:5034729-5034751 CAACGCCAGCAGGTTCTCCCTGG - Intronic
1176706638 21:10123259-10123281 CAGGGACACCAGGTTCCCCAGGG - Intergenic
1178480623 21:32976903-32976925 CCCGGCCTCCAGGTACCCCTTGG - Intergenic
1179868159 21:44228875-44228897 CAACGCCAGCAGGTTCTCCCTGG + Intronic
1180975095 22:19843915-19843937 CACCTCCACCCTGCTCCCCTAGG + Intronic
1181111960 22:20607518-20607540 CACCACCAGCATGTGCCCCTTGG + Intergenic
1183219564 22:36504021-36504043 AACAGCCACCCTGTTCCCCTAGG + Intronic
1184484608 22:44768908-44768930 CACCGCAACCCGCTTCTCCTGGG + Intronic
1184570887 22:45324271-45324293 CCCGGCCACCATGTTCTCCTTGG - Intronic
1185259978 22:49856290-49856312 CACCACCACCATGTTCCCTACGG - Intronic
950409438 3:12825660-12825682 CATCACCCCCAGCTTCCCCTGGG - Intronic
951325480 3:21297238-21297260 CCCCGCCACCAGGTGCCCAGAGG - Intergenic
953584654 3:44188753-44188775 CACCGCAACCTGCTTCTCCTGGG + Intergenic
956792777 3:72693069-72693091 CAACGACTCCAGGCTCCCCTTGG - Intergenic
958136829 3:89504619-89504641 CACTGCCACCTGGGTCTCCTTGG + Intergenic
961145263 3:124587779-124587801 CACCACAACCAGGATCTCCTGGG + Intronic
961406601 3:126684080-126684102 CAGCCCCAGCAGCTTCCCCTGGG - Intergenic
961509380 3:127391697-127391719 CACCGACACCAGGCTTCCATGGG + Intergenic
967129836 3:186460241-186460263 CACCACCACCAGTTTCCATTTGG + Intergenic
968604388 4:1525272-1525294 CCCCGGCACCAGATTCCCCAAGG + Intergenic
968739341 4:2319494-2319516 CACTGCAACCAGGTTTCCTTCGG - Intronic
969257454 4:6011851-6011873 CAGCGCCGCCAGCTTCTCCTGGG + Intergenic
969292798 4:6251586-6251608 CACTGCCACCAGGTGACCTTGGG + Intergenic
973711536 4:53634530-53634552 CACCGCCCCCAGGCTCAGCTCGG + Intronic
977313037 4:95410895-95410917 CACCACCACCTGGTTCCCTCTGG + Intronic
988775426 5:34474075-34474097 CACCTCACCCAGGTTCCTCTAGG - Intergenic
995833538 5:116378557-116378579 CACCACCACCTGCTTCCCCAAGG - Intronic
1000305957 5:159994870-159994892 CACCGCCAGTAGCATCCCCTTGG - Intergenic
1001392157 5:171388035-171388057 CACCGCCACCAGGCCCCGCTCGG - Intronic
1003279042 6:4676163-4676185 CACCTCCATCAGAATCCCCTGGG - Intergenic
1003482309 6:6545524-6545546 CATTCACACCAGGTTCCCCTGGG + Intergenic
1006188164 6:32192036-32192058 CACCTCCTCCAGACTCCCCTTGG - Intronic
1006301933 6:33198351-33198373 CACCCCCTCCAGGTGGCCCTGGG - Exonic
1006502847 6:34469139-34469161 CCCCTCCACCTGGTTCCCCAGGG - Intronic
1006904593 6:37524659-37524681 TGCCGACACCAGGTTCCCCGAGG + Intergenic
1009645445 6:66395659-66395681 TACAGCCATCAGTTTCCCCTAGG - Intergenic
1015366625 6:132402994-132403016 CACCTCCACCAGGACCCACTGGG + Intergenic
1018103879 6:160465122-160465144 CACCACCCCCAGGTACCCCAAGG - Intergenic
1018932501 6:168250447-168250469 CACCGCCCACCGGTTCCTCTTGG - Intergenic
1019143830 6:169964092-169964114 GAGCGCCTCCAGGTTCCTCTGGG + Intergenic
1019403459 7:869389-869411 CCTCACCACCAGGTACCCCTGGG - Exonic
1019686376 7:2384307-2384329 CAAGGCCCCCAGTTTCCCCTTGG + Intergenic
1019950360 7:4367319-4367341 CACTGACACCAGCCTCCCCTGGG - Intergenic
1020177559 7:5895216-5895238 CACCTCCCCCAGCTTCCCCAGGG + Intergenic
1020305357 7:6829730-6829752 CACCTCCCCCAGCTTCCCCAGGG - Intergenic
1021053749 7:16021107-16021129 CACCCCCATCTGCTTCCCCTAGG - Intergenic
1026635830 7:72080816-72080838 AACAGCCATCAGCTTCCCCTGGG - Intronic
1026971836 7:74473234-74473256 TGCCCCCACCAGGTTCTCCTGGG - Intronic
1028109028 7:86916694-86916716 CAGCACCACCTGGGTCCCCTTGG - Intronic
1028838024 7:95396330-95396352 CAGCGCCACGAGCTTCCCCATGG + Exonic
1029081281 7:97975785-97975807 CACCTCCCCCAGCTTCCCCAGGG - Intergenic
1029349932 7:100005957-100005979 CTCAGCCACCAGGTCCTCCTGGG + Intergenic
1032408335 7:131674094-131674116 CACTGACACCAGGGTCCCCAAGG + Intergenic
1033004473 7:137546400-137546422 CACAGCCATCAGGTTTCCCCAGG + Intronic
1034163263 7:149007580-149007602 AACTGGCCCCAGGTTCCCCTTGG + Intronic
1036511859 8:9407699-9407721 CTCAGGCACCAGATTCCCCTGGG - Intergenic
1036922681 8:12872921-12872943 CACAGCCATCAATTTCCCCTAGG + Intergenic
1038406041 8:27323710-27323732 CTCCGCCATCAGGTCTCCCTAGG - Intronic
1038424252 8:27454266-27454288 CACCACCACCACGTAGCCCTCGG - Exonic
1039894763 8:41708925-41708947 CACCTCCACCTGGTTCTGCTTGG + Exonic
1040023442 8:42761039-42761061 CTCAGACACCAGCTTCCCCTGGG + Intronic
1043338280 8:79204312-79204334 CACTGTCACCAGTTTCTCCTCGG - Intergenic
1047202736 8:122780678-122780700 GGCAGCCCCCAGGTTCCCCTAGG - Intergenic
1049345931 8:142138671-142138693 CAACACCACCAGCTTGCCCTTGG + Intergenic
1053643933 9:40110379-40110401 CAGGGACACCAGGTTCCCCAGGG - Intergenic
1053762219 9:41355110-41355132 CAGGGACACCAGGTTCCCCAGGG + Intergenic
1054324789 9:63707608-63707630 CAGGGACACCAGGTTCCCCAAGG - Intergenic
1054540816 9:66266230-66266252 CAGGGACACCAGGTTCCCCAGGG + Intergenic
1056654570 9:88498425-88498447 CACCGCCACCTGTGTCCCCCAGG - Intergenic
1058909135 9:109505156-109505178 CACAGCCACCAGGTCACCATGGG + Intergenic
1061400872 9:130367651-130367673 CACCGCGACCAGCCTCCCCCTGG - Intronic
1062039775 9:134398906-134398928 CATCTCCACCAGGTAGCCCTGGG - Intronic
1062452359 9:136620999-136621021 CACCGCCACCTGGGGCCCCCCGG + Intergenic
1190304739 X:49075577-49075599 CAGCTCCACCAGTTTCTCCTTGG + Exonic
1192491352 X:71579295-71579317 CAACGCCACCAAGTACTCCTAGG - Intronic
1200806124 Y:7435382-7435404 CACCGCCCCCCCGTCCCCCTGGG - Intergenic