ID: 1161298817

View in Genome Browser
Species Human (GRCh38)
Location 19:3533004-3533026
Sequence AGTCACCCCCGAGACTGTCC TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total
Summary

Found 9 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1161298817_1161298828 14 Left 1161298817 19:3533004-3533026 CCAGGACAGTCTCGGGGGTGACT No data
Right 1161298828 19:3533041-3533063 AGGGGCTGTGGGCCCCGTTTGGG No data
1161298817_1161298822 -6 Left 1161298817 19:3533004-3533026 CCAGGACAGTCTCGGGGGTGACT No data
Right 1161298822 19:3533021-3533043 GTGACTTGCAGGTGGGGCAGAGG No data
1161298817_1161298824 -4 Left 1161298817 19:3533004-3533026 CCAGGACAGTCTCGGGGGTGACT No data
Right 1161298824 19:3533023-3533045 GACTTGCAGGTGGGGCAGAGGGG No data
1161298817_1161298823 -5 Left 1161298817 19:3533004-3533026 CCAGGACAGTCTCGGGGGTGACT No data
Right 1161298823 19:3533022-3533044 TGACTTGCAGGTGGGGCAGAGGG No data
1161298817_1161298829 24 Left 1161298817 19:3533004-3533026 CCAGGACAGTCTCGGGGGTGACT No data
Right 1161298829 19:3533051-3533073 GGCCCCGTTTGGGTCCTTGTTGG No data
1161298817_1161298826 3 Left 1161298817 19:3533004-3533026 CCAGGACAGTCTCGGGGGTGACT No data
Right 1161298826 19:3533030-3533052 AGGTGGGGCAGAGGGGCTGTGGG No data
1161298817_1161298825 2 Left 1161298817 19:3533004-3533026 CCAGGACAGTCTCGGGGGTGACT No data
Right 1161298825 19:3533029-3533051 CAGGTGGGGCAGAGGGGCTGTGG No data
1161298817_1161298830 25 Left 1161298817 19:3533004-3533026 CCAGGACAGTCTCGGGGGTGACT No data
Right 1161298830 19:3533052-3533074 GCCCCGTTTGGGTCCTTGTTGGG No data
1161298817_1161298827 13 Left 1161298817 19:3533004-3533026 CCAGGACAGTCTCGGGGGTGACT No data
Right 1161298827 19:3533040-3533062 GAGGGGCTGTGGGCCCCGTTTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1161298817 Original CRISPR AGTCACCCCCGAGACTGTCC TGG (reversed) Intronic