ID: 1161298817

View in Genome Browser
Species Human (GRCh38)
Location 19:3533004-3533026
Sequence AGTCACCCCCGAGACTGTCC TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 125
Summary {0: 1, 1: 0, 2: 0, 3: 4, 4: 120}

Found 9 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1161298817_1161298829 24 Left 1161298817 19:3533004-3533026 CCAGGACAGTCTCGGGGGTGACT 0: 1
1: 0
2: 0
3: 4
4: 120
Right 1161298829 19:3533051-3533073 GGCCCCGTTTGGGTCCTTGTTGG 0: 1
1: 0
2: 0
3: 12
4: 73
1161298817_1161298825 2 Left 1161298817 19:3533004-3533026 CCAGGACAGTCTCGGGGGTGACT 0: 1
1: 0
2: 0
3: 4
4: 120
Right 1161298825 19:3533029-3533051 CAGGTGGGGCAGAGGGGCTGTGG 0: 1
1: 1
2: 18
3: 151
4: 1430
1161298817_1161298823 -5 Left 1161298817 19:3533004-3533026 CCAGGACAGTCTCGGGGGTGACT 0: 1
1: 0
2: 0
3: 4
4: 120
Right 1161298823 19:3533022-3533044 TGACTTGCAGGTGGGGCAGAGGG 0: 1
1: 0
2: 3
3: 24
4: 289
1161298817_1161298822 -6 Left 1161298817 19:3533004-3533026 CCAGGACAGTCTCGGGGGTGACT 0: 1
1: 0
2: 0
3: 4
4: 120
Right 1161298822 19:3533021-3533043 GTGACTTGCAGGTGGGGCAGAGG 0: 1
1: 1
2: 8
3: 34
4: 361
1161298817_1161298827 13 Left 1161298817 19:3533004-3533026 CCAGGACAGTCTCGGGGGTGACT 0: 1
1: 0
2: 0
3: 4
4: 120
Right 1161298827 19:3533040-3533062 GAGGGGCTGTGGGCCCCGTTTGG 0: 1
1: 0
2: 1
3: 13
4: 268
1161298817_1161298830 25 Left 1161298817 19:3533004-3533026 CCAGGACAGTCTCGGGGGTGACT 0: 1
1: 0
2: 0
3: 4
4: 120
Right 1161298830 19:3533052-3533074 GCCCCGTTTGGGTCCTTGTTGGG 0: 1
1: 0
2: 0
3: 4
4: 60
1161298817_1161298826 3 Left 1161298817 19:3533004-3533026 CCAGGACAGTCTCGGGGGTGACT 0: 1
1: 0
2: 0
3: 4
4: 120
Right 1161298826 19:3533030-3533052 AGGTGGGGCAGAGGGGCTGTGGG 0: 1
1: 0
2: 6
3: 109
4: 799
1161298817_1161298824 -4 Left 1161298817 19:3533004-3533026 CCAGGACAGTCTCGGGGGTGACT 0: 1
1: 0
2: 0
3: 4
4: 120
Right 1161298824 19:3533023-3533045 GACTTGCAGGTGGGGCAGAGGGG 0: 1
1: 1
2: 3
3: 51
4: 444
1161298817_1161298828 14 Left 1161298817 19:3533004-3533026 CCAGGACAGTCTCGGGGGTGACT 0: 1
1: 0
2: 0
3: 4
4: 120
Right 1161298828 19:3533041-3533063 AGGGGCTGTGGGCCCCGTTTGGG 0: 1
1: 0
2: 0
3: 12
4: 146

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1161298817 Original CRISPR AGTCACCCCCGAGACTGTCC TGG (reversed) Intronic
900159649 1:1217452-1217474 AGTCACCCGCGAGGCCGCCCCGG + Exonic
901269788 1:7942709-7942731 CCTCACCCCCGAGAGTGGCCAGG - Intronic
901417604 1:9128501-9128523 TGGCGCCCCCGAGGCTGTCCTGG - Intronic
903202614 1:21754790-21754812 AGTCACCTGAGAGAGTGTCCGGG - Intronic
903923381 1:26817255-26817277 CGTCAGCGCCGCGACTGTCCCGG - Intergenic
904794781 1:33051125-33051147 CGTCAGCGCCGCGACTGTCCCGG - Intronic
904860820 1:33536543-33536565 TGTCACAACCCAGACTGTCCAGG + Intronic
906436885 1:45803851-45803873 CGTCAGCGCCGCGACTGTCCCGG - Exonic
906486611 1:46240286-46240308 CGTCAGCGCCGCGACTGTCCTGG - Intergenic
908520265 1:64934803-64934825 TGTCACCCACCAGACTATCCTGG + Intronic
918050649 1:180969767-180969789 TGCCACCCCCGAGGCCGTCCTGG + Intergenic
921414490 1:214870633-214870655 CGTCAGCGCCGCGACTGTCCCGG + Intergenic
921523040 1:216181002-216181024 AGTCACCCCTGAGAGTTTCGGGG - Intronic
1069745594 10:70713024-70713046 ACTCACCCCCGCCACTGCCCTGG - Intronic
1072950165 10:99840316-99840338 CGTCAGCGCCGCGACTGTCCTGG + Intronic
1073797161 10:107001043-107001065 AGTCACTCCAGAGACTAGCCTGG - Intronic
1074769885 10:116726438-116726460 AGCCTCCCCCGAGACAGGCCTGG + Intronic
1075180052 10:120203060-120203082 AGTCAGTCACCAGACTGTCCAGG - Intergenic
1075668057 10:124244741-124244763 ACTCACCACCCAGGCTGTCCTGG + Intergenic
1077420154 11:2446245-2446267 AGTCACCTCCGGGAAGGTCCAGG + Intronic
1083721748 11:64606980-64607002 AGTCAGCCCCGGGACTGACGAGG + Exonic
1084469893 11:69353435-69353457 AGCCACCTCCCAGACTGGCCTGG + Intronic
1084586724 11:70066771-70066793 AAGCACCCCGGAGGCTGTCCTGG + Intergenic
1088730443 11:112677087-112677109 AGACACCCCAGATACTGTGCTGG - Intergenic
1088822527 11:113468880-113468902 AGTCACTCCTGTGTCTGTCCAGG + Intronic
1092167991 12:6354821-6354843 AATCGCCCCCAAGTCTGTCCAGG + Exonic
1095439304 12:42226984-42227006 CGTCAGCGCCGCGACTGTCCCGG - Intronic
1097240113 12:57569300-57569322 AGTTTCCCCCGAGAGAGTCCTGG - Exonic
1097415054 12:59304770-59304792 ACTCACCACAGATACTGTCCTGG + Intergenic
1102393012 12:112564536-112564558 AGTCACCCTCGGGGCTGTCTGGG - Intergenic
1104836279 12:131793897-131793919 ACTCTCCCCCGAGCCCGTCCTGG - Intronic
1122655919 14:103259209-103259231 ATTCACCCCCTAAACTCTCCTGG - Intergenic
1122964063 14:105112886-105112908 CGTCAGCGCCGCGACTGTCCTGG + Intergenic
1123123048 14:105926945-105926967 AGTCACCCCTCAGGCAGTCCTGG + Intronic
1128799945 15:70490940-70490962 AGTCGCCCCCGTGATTCTCCGGG + Intergenic
1129279548 15:74473501-74473523 TGTCACCTCAGGGACTGTCCTGG + Intergenic
1129428234 15:75480616-75480638 CGTCAGCGCCGCGACTGTCCCGG - Intronic
1132350749 15:101138384-101138406 AGTAGCCCCAGAGACTGGCCTGG + Intergenic
1132671372 16:1103450-1103472 AGGCAGCTCCGAGCCTGTCCCGG + Intergenic
1133022545 16:2973187-2973209 ACTCTCCCCTGAGGCTGTCCTGG - Exonic
1133315721 16:4882766-4882788 TGTCAGCCACCAGACTGTCCCGG - Exonic
1133856105 16:9550690-9550712 AGACACACCAGAGAATGTCCTGG - Intergenic
1134182560 16:12059420-12059442 AGCCGCTCCCGCGACTGTCCTGG - Intronic
1135955874 16:26955817-26955839 AGGCACTGCCAAGACTGTCCAGG - Intergenic
1136612714 16:31377023-31377045 CGTCTCCCCCAAGGCTGTCCTGG + Exonic
1138023346 16:53503579-53503601 AGTCACCACGGAGACCTTCCCGG + Intronic
1140032676 16:71350968-71350990 GGTGACTCCCGAGACTGTCTGGG - Intergenic
1150473716 17:65458584-65458606 ATTCACCCCGGAAACTGACCTGG + Intergenic
1151948381 17:77331752-77331774 AGGCACCCCCGTGCCTGTGCGGG - Intronic
1152224869 17:79088051-79088073 AGCCAGCCCGGGGACTGTCCTGG + Intronic
1152807572 17:82363603-82363625 TGGCACCCCTGAGATTGTCCTGG - Exonic
1153590830 18:6672791-6672813 AGTCACCTCCGAGCCTCTCTGGG + Intergenic
1157403189 18:47403043-47403065 AGTCACCCAGGAGACTGCCTGGG + Intergenic
1160957233 19:1699351-1699373 TCTCACCCCCGAGACAGCCCAGG - Intergenic
1161298817 19:3533004-3533026 AGTCACCCCCGAGACTGTCCTGG - Intronic
1162886650 19:13702585-13702607 CGTCAGCGCCGCGACTGTCCCGG - Intergenic
1164191869 19:22925332-22925354 CGTCAGCGCCGCGACTGTCCCGG - Intergenic
1164653381 19:29901892-29901914 CGTCAGCGCCGCGACTGTCCTGG + Intergenic
1165139177 19:33688841-33688863 AGCCACCCCCTGCACTGTCCAGG - Intronic
1166261387 19:41644011-41644033 CGTCAGCGCCGCGACTGTCCTGG - Intronic
925076785 2:1023239-1023261 AATCACCCCCCAGCCTGGCCTGG + Intronic
929856189 2:45640322-45640344 AGTCATCCCCGACTCTTTCCTGG - Intergenic
934623762 2:95832318-95832340 AGCCACCCCCGCCAGTGTCCTGG - Intergenic
934809994 2:97269792-97269814 AGCCACCCCCGCCAGTGTCCTGG + Intergenic
934827698 2:97438147-97438169 AGCCACCCCCGCCAGTGTCCTGG - Intergenic
939900540 2:147844728-147844750 AGTCAGTTCCCAGACTGTCCGGG + Exonic
1170115132 20:12849664-12849686 TGTCACCACCGAGACTATCAAGG + Intergenic
1175218949 20:57406034-57406056 AGTCACCCCCCAGGCGGGCCTGG + Intronic
1176376337 21:6088608-6088630 ACCCACCCTCGAGACTGTCATGG + Intergenic
1177970099 21:27778309-27778331 TGTCACCACCGAGACTGAGCTGG - Intergenic
1179747138 21:43449636-43449658 ACCCACCCTCGAGACTGTCATGG - Intergenic
1179818012 21:43920503-43920525 AGTCCCCCAGGAGGCTGTCCTGG - Intronic
1180167051 21:46035772-46035794 AGGCCCCGCAGAGACTGTCCCGG + Intergenic
1183103934 22:35602502-35602524 AGTCACCCCCAGGACAGCCCAGG - Intergenic
1183335585 22:37244160-37244182 TGTCACCACCGACACTCTCCAGG - Exonic
1184943038 22:47782705-47782727 AGCCACCCCAGAGACTGATCAGG - Intergenic
950253910 3:11488496-11488518 TGTCAGCGCCGCGACTGTCCCGG + Intronic
952525949 3:34210755-34210777 AGTCACCCCTGAGGCAGCCCAGG - Intergenic
953069575 3:39505932-39505954 AGCCACTCCCCAGACTGTCCTGG + Intronic
959734931 3:109647895-109647917 AGTCACCCGAGGGACTCTCCTGG - Intergenic
961633982 3:128321494-128321516 GGTCTGCCCAGAGACTGTCCTGG - Intronic
962923268 3:139969877-139969899 TGTGACACCCTAGACTGTCCTGG + Intronic
969151918 4:5176930-5176952 AGTCACCCCTCAGACTCTCTGGG + Intronic
970415288 4:15850845-15850867 GGTCACCCAGGAGACTGACCGGG - Exonic
975664258 4:76719191-76719213 AAACACCCCCAAGACTGTCATGG - Intronic
975766704 4:77676182-77676204 ATTCTCCCCCCAGACTGTGCAGG + Intergenic
980165245 4:129218470-129218492 AGTCACCTACAAGACTTTCCAGG + Intergenic
982616145 4:157637944-157637966 CGTCAGCGCCGCGACTGTCCCGG + Intergenic
985758321 5:1732389-1732411 AGGCACCCCCCAGGCTGACCTGG + Intergenic
986789520 5:11145986-11146008 ACCCACCCCAGAGTCTGTCCGGG - Intronic
987073217 5:14357665-14357687 ATTCACCACCGAGCCTGGCCAGG - Intronic
987086767 5:14477218-14477240 AGACACCCCAGATACTGTTCAGG - Intronic
988366511 5:30307512-30307534 AGTCACCCAGGACACTGTTCTGG + Intergenic
992373672 5:76170885-76170907 CGTCAGCGCCGCGACTGTCCCGG - Intronic
993863008 5:93159059-93159081 CGTCACCCCAGTGACTGTGCTGG + Intergenic
1000985202 5:167858655-167858677 CGTCAGCGCCGCGACTGTCCCGG - Intronic
1002341460 5:178518993-178519015 CGTCAGCGCCGCGACTGTCCCGG + Intronic
1007674475 6:43581743-43581765 CGTCAGCGCCGCGACTGTCCCGG + Intronic
1015476491 6:133664115-133664137 CGTCAGCGCCGCGACTGTCCCGG - Intergenic
1018686397 6:166307707-166307729 TCTCACCCCCGAGGCCGTCCTGG - Exonic
1018724317 6:166598962-166598984 AGTAACCCCTGAGACAGGCCGGG - Intronic
1018768881 6:166955753-166955775 AGTCACCCCAGAGCGTGCCCAGG + Intronic
1021525908 7:21587547-21587569 AGCCACCCCCAACAGTGTCCTGG - Intronic
1030068378 7:105677940-105677962 ACTCACCCCACAGACTGTCGTGG + Intronic
1032080679 7:128857025-128857047 AGTCCCCACAGAGGCTGTCCAGG + Intronic
1034488524 7:151380988-151381010 AGTCACCCCCAAGGCTGCCCAGG + Intronic
1039569448 8:38575415-38575437 ATTCTCCCCCGAGGCTGGCCAGG + Intergenic
1039983555 8:42428921-42428943 AGTCACCCCAGAGAATGTTCTGG - Intronic
1040333187 8:46402765-46402787 AGAAGCCCCCAAGACTGTCCTGG + Intergenic
1040878008 8:52173438-52173460 AGCCACCCCATAGACTGTCCTGG - Intronic
1044560091 8:93604307-93604329 AGTCCCCACTGAGTCTGTCCTGG + Intergenic
1046681121 8:117171355-117171377 AGTCAGCCCCAAGAATGTCGTGG - Intronic
1047687075 8:127315705-127315727 CGTCAGCGCCGCGACTGTCCCGG - Intergenic
1049995750 9:1032223-1032245 ATTCACTCCCGATACTGTCTGGG - Intergenic
1053457025 9:38241376-38241398 CGTCAGCGCCGCGACTGTCCCGG - Intergenic
1053750798 9:41252243-41252265 AGCCACCACTGAGACTGTGCTGG - Intergenic
1053912681 9:42922264-42922286 AGTCACCCCCGTGATTACCCAGG + Intergenic
1054256313 9:62816586-62816608 AGCCACCACTGAGACTGTGCTGG - Intergenic
1057550593 9:96048879-96048901 AGCCACCACCCAGACTGCCCTGG - Intergenic
1057659771 9:96990398-96990420 AGTCCTCCTCAAGACTGTCCAGG + Intronic
1059117299 9:111611101-111611123 AGTAACCCCAGAGATTCTCCAGG + Intergenic
1059210817 9:112513536-112513558 CGTCAGCGCCGCGACTGTCCCGG - Intronic
1060064736 9:120494889-120494911 CGTCAGCGCCGCGACTGTCCTGG - Intronic
1191999995 X:67139535-67139557 ACTCACCCATGAAACTGTCCTGG - Intergenic
1192621037 X:72680670-72680692 CGTCAGCGCCGCGACTGTCCTGG - Intronic