ID: 1161300475

View in Genome Browser
Species Human (GRCh38)
Location 19:3540181-3540203
Sequence GAAGAATCCTAGAACCTGGG AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 3940
Summary {0: 1, 1: 3, 2: 73, 3: 347, 4: 3516}

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1161300475_1161300479 3 Left 1161300475 19:3540181-3540203 CCTCCCAGGTTCTAGGATTCTTC 0: 1
1: 3
2: 73
3: 347
4: 3516
Right 1161300479 19:3540207-3540229 CTCAAGCCTTCTGAGTAGCTAGG 0: 6
1: 121
2: 790
3: 13295
4: 128207
1161300475_1161300481 11 Left 1161300475 19:3540181-3540203 CCTCCCAGGTTCTAGGATTCTTC 0: 1
1: 3
2: 73
3: 347
4: 3516
Right 1161300481 19:3540215-3540237 TTCTGAGTAGCTAGGACTACAGG 0: 154
1: 4697
2: 57036
3: 179799
4: 230364

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1161300475 Original CRISPR GAAGAATCCTAGAACCTGGG AGG (reversed) Intronic
Too many off-targets to display for this crispr