ID: 1161302192

View in Genome Browser
Species Human (GRCh38)
Location 19:3548077-3548099
Sequence GCCTGAAGTCCTCGAGCCAG GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 110
Summary {0: 1, 1: 0, 2: 1, 3: 7, 4: 101}

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1161302192_1161302205 22 Left 1161302192 19:3548077-3548099 CCCCTGGCTCGAGGACTTCAGGC 0: 1
1: 0
2: 1
3: 7
4: 101
Right 1161302205 19:3548122-3548144 CCCGGAACACGGGCACGTCCTGG 0: 1
1: 0
2: 1
3: 3
4: 46
1161302192_1161302201 11 Left 1161302192 19:3548077-3548099 CCCCTGGCTCGAGGACTTCAGGC 0: 1
1: 0
2: 1
3: 7
4: 101
Right 1161302201 19:3548111-3548133 ACTCCAGCTCACCCGGAACACGG 0: 1
1: 0
2: 0
3: 8
4: 100
1161302192_1161302202 12 Left 1161302192 19:3548077-3548099 CCCCTGGCTCGAGGACTTCAGGC 0: 1
1: 0
2: 1
3: 7
4: 101
Right 1161302202 19:3548112-3548134 CTCCAGCTCACCCGGAACACGGG 0: 1
1: 0
2: 0
3: 14
4: 99
1161302192_1161302198 4 Left 1161302192 19:3548077-3548099 CCCCTGGCTCGAGGACTTCAGGC 0: 1
1: 0
2: 1
3: 7
4: 101
Right 1161302198 19:3548104-3548126 CACCCGGACTCCAGCTCACCCGG 0: 1
1: 0
2: 0
3: 17
4: 149

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1161302192 Original CRISPR GCCTGAAGTCCTCGAGCCAG GGG (reversed) Intronic
900971850 1:5996218-5996240 GCAGGAAAGCCTCGAGCCAGTGG - Intronic
917151641 1:171952030-171952052 GTCTGAAGACCTCAAGTCAGTGG + Intronic
921308871 1:213823475-213823497 GCTTGAAAACCTTGAGCCAGAGG + Intergenic
921768645 1:219006442-219006464 GATTGAAGTCCTAGAGGCAGAGG - Intergenic
921992096 1:221378013-221378035 GCCTGAAATCCTTGGCCCAGAGG - Intergenic
924828013 1:247562337-247562359 GCCTGAGGTCCGTGTGCCAGAGG + Intronic
1063160186 10:3413084-3413106 GCCTGAAGCCCTCTAGCCTCTGG + Intergenic
1064468131 10:15606021-15606043 GCCTGTAATCCTCAAGCCATAGG - Intronic
1067374730 10:45717427-45717449 GGCTGAAGTCCTAGACACAGAGG + Intergenic
1067882543 10:50059065-50059087 GGCTGAAGTCCTAGACACAGAGG + Intergenic
1069691492 10:70356011-70356033 GCATGAGGCCCTCCAGCCAGTGG + Intronic
1070592249 10:77809561-77809583 TCCTGACGGCCTCGTGCCAGGGG - Exonic
1074308367 10:112299698-112299720 TCCTGGAGTCTTCCAGCCAGGGG + Intronic
1076727899 10:132421856-132421878 GGCTGAAGGCCTGGAGCCGGAGG + Intergenic
1078668754 11:13346789-13346811 GCCTGTGGTCCTGGAGTCAGGGG - Intronic
1078784881 11:14479929-14479951 GCCTGAAGTCCTAGCTCCTGGGG - Intronic
1081678289 11:44983949-44983971 GACTCAGGTCCTGGAGCCAGAGG - Intergenic
1083164116 11:60873141-60873163 GCCTGAAGTCCACGTGCAAGAGG - Exonic
1088084416 11:105960251-105960273 GCCTGAGCTCCTAGAGGCAGGGG - Intronic
1090803793 11:130190199-130190221 GCCAGATGCCCTTGAGCCAGTGG + Intronic
1093297642 12:17410681-17410703 TCCCCAAGTCCTTGAGCCAGGGG - Intergenic
1101191854 12:102342356-102342378 GACTGACTTCCTCAAGCCAGGGG + Intergenic
1102539097 12:113605586-113605608 GCATGAAGACCTCGTGCTAGTGG + Intergenic
1103451671 12:121033560-121033582 TCCTCAGGTCCTCGAGCCCGAGG + Exonic
1104035988 12:125097340-125097362 GCCTGATGTCCTGAGGCCAGGGG + Intronic
1104765974 12:131330516-131330538 GCCTGGAATCCTCCATCCAGTGG + Intergenic
1119890588 14:78179264-78179286 CCCTGGAGTCCTCCAGCCTGGGG - Intergenic
1121000076 14:90445265-90445287 GCCTGAAGTCCCCCTCCCAGTGG + Intergenic
1122028874 14:98898189-98898211 GCCTGACGTCTTGGAGCCCGTGG + Intergenic
1122367293 14:101201674-101201696 TCCTGAAGCCCTCGAGGAAGTGG - Intergenic
1126065504 15:44823130-44823152 GCCTGAAGCCAGAGAGCCAGTGG + Intergenic
1126094330 15:45077461-45077483 GCCTGAAGCCAGAGAGCCAGTGG - Intergenic
1130681061 15:85997087-85997109 GCCTGGAGCCCTGGAGACAGAGG - Intergenic
1130905639 15:88239190-88239212 GCCAGAAGCCCTCCAGGCAGGGG + Intronic
1132843623 16:1990234-1990256 GCCTGAAGGTCGCGAGGCAGGGG - Intronic
1139001293 16:62513346-62513368 GCCTGAAGCCCGGGAGGCAGAGG + Intergenic
1141440323 16:84025822-84025844 GCCTGAGGTCAACGCGCCAGCGG - Intronic
1142584007 17:959408-959430 GTCTGGAGTCCTCAGGCCAGTGG - Intronic
1146275838 17:31515022-31515044 ATCAGAAGTCCTCCAGCCAGAGG - Intronic
1148792321 17:50180314-50180336 TCCTGAAGTCCCCCAGCCAGTGG - Intergenic
1150840443 17:68601255-68601277 GCCTGGACTCCTAGAGGCAGAGG + Exonic
1151207651 17:72519607-72519629 GCCAGCAGTCCCCGGGCCAGCGG - Intergenic
1152717687 17:81907724-81907746 CCCTGGAGACCTCGACCCAGGGG + Intronic
1157301238 18:46481403-46481425 GCCTGCAGTTCTCAAGCCTGTGG - Intronic
1159351917 18:67286457-67286479 GCCTGACCTCCAGGAGCCAGAGG - Intergenic
1160844169 19:1159387-1159409 GCCTGAAGGGCTGGAGCCAAGGG + Intronic
1161302192 19:3548077-3548099 GCCTGAAGTCCTCGAGCCAGGGG - Intronic
1161698680 19:5783781-5783803 GCCTGAGGGCCCCGGGCCAGAGG - Exonic
1162003634 19:7763776-7763798 GCCTGGACTCCTGGAACCAGAGG + Intronic
1162316984 19:9945567-9945589 GCCTGGCGTCCTCGTGTCAGAGG - Intergenic
1162573918 19:11487634-11487656 GCCTGAAGCCCTGGAGACAGTGG - Exonic
1164146789 19:22517564-22517586 GCCTGAAGCCCTCCAGGAAGAGG - Intronic
1165901561 19:39171748-39171770 GCCAGATGTCCTCCAGCCGGAGG - Intronic
1167632160 19:50632039-50632061 GCCTGAATTCCTGGGTCCAGAGG - Intronic
925064834 2:921853-921875 GCCGGAAGTCCCGGATCCAGGGG + Intergenic
925443729 2:3909937-3909959 CACTGAAGTCCTGGAGCCACTGG - Intergenic
929604720 2:43226722-43226744 GCCTGACGTCCGCGAGCGGGCGG - Intergenic
932440995 2:71735142-71735164 TCCTGAAGTGCTGGAGGCAGTGG + Intergenic
937109326 2:119350701-119350723 GCCTTCAGTCCTGGAGCCTGTGG + Intronic
944704269 2:202273007-202273029 GCCTGTAGTCCTGGAGGCTGAGG + Intronic
1170314475 20:15028224-15028246 GCCTGAAAACCTAGAGCCAAGGG + Intronic
1173762906 20:45579465-45579487 GCCTGGTGTGCTGGAGCCAGGGG - Intergenic
1175357594 20:58381149-58381171 GGCTGAACTCTTCCAGCCAGGGG + Intergenic
1178511974 21:33212923-33212945 GACTGAAGTCCCTGAGCAAGAGG - Intergenic
1179667342 21:42921990-42922012 GCCTGAAGTCCTGGACTAAGTGG + Intergenic
1181029472 22:20142931-20142953 GCCTCAAGGCCTCGAGCCGGCGG + Exonic
1182064624 22:27421480-27421502 ACAGGAAGTCCTGGAGCCAGTGG + Intergenic
1183217436 22:36490042-36490064 GCCAGAGGCCCTGGAGCCAGGGG + Exonic
1184128083 22:42501525-42501547 CCCTGATGTGCTTGAGCCAGGGG - Intergenic
1184136874 22:42554838-42554860 GCCTGATGTGCTTGAGCCAGGGG - Intronic
950489528 3:13295176-13295198 GCCCCAAGTCCTCCAGCCACTGG + Intergenic
954858454 3:53666778-53666800 GCCTGAAGACCTGGTGCCAAGGG + Intronic
959244357 3:103845637-103845659 GCCTAAAGTCAGCCAGCCAGAGG + Intergenic
961745628 3:129062030-129062052 GCGTGCGGTCCTCCAGCCAGAGG - Exonic
966516914 3:180829289-180829311 GCCTGGAGCCCTGGCGCCAGAGG - Intronic
968189932 3:196660294-196660316 GCCCGAAGTCCACGATGCAGGGG - Exonic
971240993 4:24888684-24888706 TGCTGAAGTCCTCCAGCCTGCGG + Intronic
971380867 4:26096240-26096262 GCCCAAAGTCACCGAGCCAGAGG - Intergenic
977706750 4:100080200-100080222 GGCTGTAGTCCTCTAGTCAGGGG + Intergenic
984750787 4:183271879-183271901 GCCTGAAGTCCTTGCTCCTGGGG + Intronic
985224466 4:187745208-187745230 GGTTGAAGTCCTGGAACCAGGGG - Intergenic
985732297 5:1556161-1556183 TCCTGGAGGCCTCGGGCCAGGGG - Intergenic
994832104 5:104797277-104797299 GCCTGTAGTCCTAGCTCCAGAGG + Intergenic
996574059 5:124962978-124963000 GCCGGAAGTGCTCTAGCCAGGGG + Intergenic
996831254 5:127743058-127743080 GGCTGAACTCATCAAGCCAGAGG - Intergenic
999273346 5:150311564-150311586 GCCTGAAGTCCTGGATCCAGGGG - Intronic
1000406466 5:160893221-160893243 GGCTGAAGCCATGGAGCCAGTGG + Intergenic
1001927113 5:175645874-175645896 GCCTGGACACCACGAGCCAGGGG - Intergenic
1003489655 6:6610350-6610372 GCCTGAAGCTCTTGAGCCTGAGG + Intronic
1005124042 6:22425251-22425273 TCCTGAAGTCATGGAGCCATAGG + Intergenic
1006603599 6:35241738-35241760 CCCTGGATTCCTCCAGCCAGCGG + Intronic
1010276319 6:73972279-73972301 GGCTGAAGCCAGCGAGCCAGTGG + Intergenic
1012000168 6:93644757-93644779 GCCTGAAGTCCTAGAATCAAAGG + Intergenic
1013370152 6:109462369-109462391 GACTGGAGTCCTCCAACCAGAGG + Intergenic
1018628176 6:165800475-165800497 GCCTGATGTACTGGGGCCAGAGG - Intronic
1018871777 6:167789652-167789674 GCCGGAAGTCCGAGATCCAGGGG - Intronic
1023284979 7:38609431-38609453 GCCTAAAGTGCTTCAGCCAGTGG - Intronic
1027855990 7:83511810-83511832 GCTTGAACTCCGCGAGGCAGAGG + Intronic
1034413489 7:150953337-150953359 GCCTGGTGTCCTCGGGCCTGTGG - Intronic
1034555773 7:151849577-151849599 GCCTGAAGTCCAAGATCAAGGGG + Intronic
1034853884 7:154522385-154522407 GCGTGAGGCCCTTGAGCCAGAGG + Intronic
1035758534 8:2052181-2052203 CCCAGAAGTCCTTGAGTCAGCGG + Exonic
1036743550 8:11388582-11388604 GCCAGCAGTGCTCGTGCCAGAGG + Intergenic
1048261576 8:132949818-132949840 GCCTGAGGCCCCCCAGCCAGTGG + Intronic
1061673816 9:132204137-132204159 GGCTGAAGTCCTTGAGCGAGAGG + Intronic
1062262945 9:135671878-135671900 TCCTAGAGTCCTCCAGCCAGCGG - Intergenic
1185841464 X:3395539-3395561 GCCTGTAGTCCTAGAGCCTCAGG - Intergenic
1189294165 X:39907243-39907265 GCCTCAAGTCCTCGATTCATTGG + Intergenic
1199744611 X:150764055-150764077 GGCTGAATTCCTGCAGCCAGTGG - Intronic
1200231146 X:154444469-154444491 GCTGGAAGTCAGCGAGCCAGGGG - Intronic