ID: 1161302270

View in Genome Browser
Species Human (GRCh38)
Location 19:3548401-3548423
Sequence GGCCTCCAGGAAGCCCGTGC TGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 315
Summary {0: 1, 1: 0, 2: 3, 3: 43, 4: 268}

Found 6 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1161302262_1161302270 16 Left 1161302262 19:3548362-3548384 CCTGACTGACAGGTGATTCCAAC 0: 1
1: 0
2: 2
3: 12
4: 73
Right 1161302270 19:3548401-3548423 GGCCTCCAGGAAGCCCGTGCTGG 0: 1
1: 0
2: 3
3: 43
4: 268
1161302265_1161302270 -2 Left 1161302265 19:3548380-3548402 CCAACCACTGCCACACTGGGTGG 0: 1
1: 0
2: 0
3: 21
4: 244
Right 1161302270 19:3548401-3548423 GGCCTCCAGGAAGCCCGTGCTGG 0: 1
1: 0
2: 3
3: 43
4: 268
1161302258_1161302270 27 Left 1161302258 19:3548351-3548373 CCTGGGGAACCCCTGACTGACAG 0: 1
1: 0
2: 0
3: 21
4: 276
Right 1161302270 19:3548401-3548423 GGCCTCCAGGAAGCCCGTGCTGG 0: 1
1: 0
2: 3
3: 43
4: 268
1161302267_1161302270 -6 Left 1161302267 19:3548384-3548406 CCACTGCCACACTGGGTGGCCTC 0: 1
1: 0
2: 2
3: 32
4: 280
Right 1161302270 19:3548401-3548423 GGCCTCCAGGAAGCCCGTGCTGG 0: 1
1: 0
2: 3
3: 43
4: 268
1161302260_1161302270 18 Left 1161302260 19:3548360-3548382 CCCCTGACTGACAGGTGATTCCA 0: 1
1: 0
2: 2
3: 9
4: 128
Right 1161302270 19:3548401-3548423 GGCCTCCAGGAAGCCCGTGCTGG 0: 1
1: 0
2: 3
3: 43
4: 268
1161302261_1161302270 17 Left 1161302261 19:3548361-3548383 CCCTGACTGACAGGTGATTCCAA 0: 1
1: 0
2: 1
3: 7
4: 119
Right 1161302270 19:3548401-3548423 GGCCTCCAGGAAGCCCGTGCTGG 0: 1
1: 0
2: 3
3: 43
4: 268

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1161302270 Original CRISPR GGCCTCCAGGAAGCCCGTGC TGG Intronic
900174313 1:1285096-1285118 GGCCTCCAGGCAGCCTGGCCAGG - Intronic
901065658 1:6493023-6493045 TGCCTCCAGGAAGCCCATCCTGG + Intronic
903185126 1:21624559-21624581 GGTCTCCAGCAAGCCAGTGCTGG - Intronic
903502737 1:23810561-23810583 GGCCTCTAGGGAGCAAGTGCAGG + Intronic
903537371 1:24076020-24076042 GCCCTCCAGCAAGCCCCTGAGGG - Intronic
903662251 1:24985306-24985328 GGCCTCCAGGAAGCCTGGGGAGG + Intergenic
903835497 1:26200908-26200930 CTCCTCCAGGAACCCCTTGCGGG + Exonic
905169040 1:36099026-36099048 GGGCCCCAGGCAGCCCGGGCTGG + Exonic
905300763 1:36985003-36985025 GGGCTCCGTGAAGCCCGGGCAGG + Intronic
905924184 1:41738176-41738198 GGCCTCTAGGAAGGACGAGCGGG + Intronic
907623956 1:56010476-56010498 GGCCTCCAGCCACCCCCTGCTGG + Intergenic
907855507 1:58299884-58299906 TGCCTCCAGGAAGCATGTGGAGG - Intronic
908901886 1:68965018-68965040 GGCCACCTGGAAGCCAGTCCTGG + Intergenic
913127847 1:115809753-115809775 GGCCTCCAGAAAGCCACTACTGG - Intergenic
915781996 1:158562686-158562708 GGCCTTCAGGAAGACAGTGATGG - Exonic
917609601 1:176673496-176673518 GGCCTCATGGAAGCCACTGCTGG - Intronic
919933501 1:202236529-202236551 GGCTTCCACGATGCCCCTGCTGG - Intronic
920074587 1:203327174-203327196 TGACTCCAGGCAGCCCGTGTGGG - Intergenic
922734927 1:227973697-227973719 GGCCGCCAGGAGGCCCAAGCTGG - Intergenic
923500246 1:234558648-234558670 GGCCTCTAGGAAGCCGGTACAGG - Intergenic
924343291 1:243054153-243054175 GGCCGCCAGGAGGCCCAAGCTGG + Intergenic
1065879363 10:30026244-30026266 GGCCTCCCGGGAGCCCGGCCTGG + Exonic
1066358787 10:34710927-34710949 GCACTCCAGGAAGCCAGGGCAGG + Intronic
1066733203 10:38451439-38451461 GGCCGCCAGGAGGCCGGAGCTGG - Intergenic
1067025976 10:42844750-42844772 TGCCTTCAGGAAGCCTCTGCTGG + Intergenic
1067235069 10:44440041-44440063 GCCCTGCAGGAAGCCCCAGCTGG + Intergenic
1067806249 10:49395362-49395384 GGTCTCCATGAAGCCAGAGCCGG - Intronic
1069553862 10:69383821-69383843 AGCCTCCTGGAAGCCCAGGCTGG + Intronic
1069686545 10:70322653-70322675 GGCCTCTGGGAAGCCCCTGGGGG - Intronic
1070663555 10:78327891-78327913 GGCCTCCAAGCAGCATGTGCAGG + Intergenic
1070982182 10:80657809-80657831 GGTCTCCAGGAAGCAGGGGCTGG + Intergenic
1071666601 10:87564407-87564429 GGCCCCCAGGTAGCATGTGCAGG - Intergenic
1073425300 10:103452214-103452236 GGCCTCCAGGAGGGCGGTGCAGG + Exonic
1073473954 10:103740847-103740869 GGCCTCCATCAAGACAGTGCTGG - Intronic
1074898380 10:117796186-117796208 GTCCTGGAGGAAGCCAGTGCTGG + Intergenic
1079626723 11:22625439-22625461 GGCGTCCCGGACGCCCGGGCCGG + Exonic
1080648975 11:34207937-34207959 GGCCTCCAGGAACCCTTGGCAGG - Intronic
1081612479 11:44570901-44570923 GGCCTCCAGGAAGCCCATCCTGG + Intronic
1081764354 11:45599182-45599204 GCAATCCAGGAAGCCCCTGCTGG + Intergenic
1082973094 11:59043882-59043904 GGCCTCCATTCAGCCCCTGCAGG - Intergenic
1082977489 11:59087447-59087469 GGCCTCCATTCAGCCCCTGCAGG - Intergenic
1083389434 11:62337312-62337334 TGCCACCAGGAAGCTCGGGCCGG + Intergenic
1083936301 11:65871808-65871830 GGCCTCCAGAGAGCCAGAGCTGG + Intronic
1084274357 11:68043998-68044020 GGCCTCCAGGAGGTGGGTGCAGG + Intronic
1084274372 11:68044039-68044061 GGCCTCCAGGAGGTGGGTGCAGG + Intronic
1085025077 11:73231652-73231674 TGCCTCCGGGAAGCCAGGGCTGG + Intronic
1085201481 11:74704880-74704902 GGCCTCCACGAAGCCCTTCTTGG + Intronic
1085390727 11:76180832-76180854 GGCCTGCAGGAAGACCATCCAGG + Intergenic
1085687182 11:78633781-78633803 GGCCTCCAGATGGCACGTGCTGG - Intergenic
1086936147 11:92747459-92747481 GGCCTCCAGGAAGCCTGTGATGG + Intronic
1088686252 11:112286755-112286777 TGCCTCCAGGAAGCCTGTCCTGG - Intergenic
1089699828 11:120237903-120237925 GGCCTCCAATAAGCCCTTGCTGG + Intronic
1091801412 12:3326933-3326955 GTCCTCCGGGAAGCTCCTGCCGG + Intergenic
1095388914 12:41682061-41682083 GGCCTTCAGGGAGCCCCTGCTGG - Intergenic
1095672362 12:44876232-44876254 GGCCCCAAGAAAGCCCGGGCTGG + Intronic
1098790486 12:74816550-74816572 GGGGCCCAGGAAGCCCCTGCAGG + Intergenic
1102045582 12:109828219-109828241 GGCGCACAGGAAGCCCTTGCCGG - Intronic
1102515597 12:113444253-113444275 GGCCTCCAGGAAGCTCAGGCAGG - Intergenic
1103943389 12:124512949-124512971 AGCCTCCAGGAAGCCCTCCCTGG - Intronic
1104462942 12:128969973-128969995 GGCCTCCAGGAAGCGCACACAGG - Intronic
1104901943 12:132194198-132194220 GGCCACCAGGATGTCCTTGCTGG - Intergenic
1105208977 13:18246851-18246873 GGCCTCCAGCCAGCCCGGCCAGG + Intergenic
1113095612 13:106660863-106660885 GCCCTCCACGAAGCCCCTGATGG + Intergenic
1113418874 13:110154422-110154444 GGCCTCCACGAAGGCCCTCCTGG - Intronic
1114259140 14:21025082-21025104 GGTCTGCGGGAAGCCCGAGCCGG - Intronic
1115374411 14:32657578-32657600 AGTCTCTAGTAAGCCCGTGCTGG - Intronic
1115643426 14:35350200-35350222 GGCCCCAAGGAAACACGTGCTGG - Intergenic
1117516972 14:56511620-56511642 GGCCTCCTGGTAGCCAGTACAGG + Intronic
1118258507 14:64225659-64225681 GGGCTCCAGGGAGCCCGTGCTGG - Exonic
1118777185 14:68980038-68980060 GGCCTCCCGGAATTCCCTGCCGG + Intergenic
1122881733 14:104693355-104693377 GGCCCCCAGGCAGCCCTTGGTGG + Intronic
1122904613 14:104795940-104795962 GGCCACCAGCCAGCCCGTCCCGG + Intergenic
1122951901 14:105049883-105049905 GGCTTCCAGGGAGGCCGCGCAGG - Exonic
1123068358 14:105629221-105629243 GGCCTCCAGGACGACCGGGCTGG - Intergenic
1123092377 14:105747545-105747567 GGCCTCCAGGACGACCGGGCTGG - Intergenic
1123097955 14:105775246-105775268 GGCCTCCAGGACGACCGGGCTGG - Intergenic
1123451051 15:20358797-20358819 GGACCCCAGGAAGCCCCTCCAGG - Intergenic
1123739777 15:23225789-23225811 AGCCCCCAGGAGGCCGGTGCGGG + Intergenic
1127256478 15:57297826-57297848 GGCCCCCAGTCAGCCCGGGCAGG - Intronic
1128371729 15:67044612-67044634 GGCCTCAAGCAAGCCCTTCCTGG + Intergenic
1128603000 15:69013681-69013703 GGCTTCCAGTGAGCCCCTGCTGG + Intronic
1129207233 15:74044467-74044489 GGCAGCCAGGAAGCCCGAGATGG - Exonic
1129229530 15:74189088-74189110 GGCCTCCAGGGAGCCCCTGAGGG - Intronic
1129268471 15:74407405-74407427 GGCCCTCAAGAAGCCAGTGCTGG + Intergenic
1130844972 15:87735765-87735787 GGCCTCCAGGCAGGCCAGGCAGG + Intergenic
1131912634 15:97224532-97224554 GGCCACGCGGAAGCCCATGCGGG - Intergenic
1132292639 15:100714088-100714110 GGCCCCCTGGGAGCACGTGCAGG + Intergenic
1133064050 16:3193427-3193449 GGGCTCCGCGAAGCCCATGCGGG + Intergenic
1133127614 16:3656618-3656640 GGCCTGCGGGAAGGCCGGGCAGG - Exonic
1133239078 16:4403983-4404005 GGCCCCCAGGGAGCCCCTTCTGG - Intronic
1134335837 16:13298945-13298967 GGCTTCCAGGCACCCCATGCAGG - Intergenic
1134811256 16:17168795-17168817 GTCCTCCAGGAAGCAGCTGCAGG + Intronic
1136051751 16:27655767-27655789 GGCCTCAGGGAAGCCCCTGCTGG + Intronic
1136202950 16:28700620-28700642 AGCCTCCACGGAGCCTGTGCGGG - Intronic
1136300268 16:29329600-29329622 GGCCTCCCGGGAGCTCATGCTGG + Intergenic
1136843599 16:33558552-33558574 GGCTTTCAGGAAGCCCCTTCAGG + Intergenic
1139582319 16:67880832-67880854 GGCCTCCATCAAGCCCGAGCTGG - Exonic
1140055428 16:71521567-71521589 GGCCTCCAGGAAGATAGTGGTGG - Intronic
1142061998 16:88036364-88036386 GGCCTCCTGGGAGCTCATGCTGG + Intronic
1142227465 16:88884631-88884653 GGCCTCACGGCAGCCCTTGCTGG + Intronic
1142270710 16:89088074-89088096 GGCCTCCAGGATGGCCCTGGGGG - Intergenic
1203153764 16_KI270728v1_random:1858850-1858872 GGCTTTCAGGAAGCCCCTTCAGG + Intergenic
1142598308 17:1040189-1040211 GGCCCCCAGGACGCACGCGCAGG + Intronic
1144637619 17:16920336-16920358 GGCCTTCCTAAAGCCCGTGCTGG + Intergenic
1145826293 17:27879590-27879612 CACCTCCAAGAAGCCCCTGCAGG - Intronic
1145909507 17:28534422-28534444 GGCCCACAGGCAGCCCTTGCGGG - Exonic
1146198356 17:30832281-30832303 GGCCTCCAGGCAGGCCGGGCTGG + Exonic
1146651036 17:34606587-34606609 GGCTTCCAGGAAGTCTGTGAGGG - Intronic
1147398443 17:40163647-40163669 GGCTTCAAGGAAGGTCGTGCTGG + Exonic
1148185030 17:45636689-45636711 CGCCTCCATGAAGCCCGCTCTGG - Intergenic
1148850449 17:50551977-50551999 GTCCTCCAGGAAGCCCCAGCAGG - Exonic
1150108284 17:62478207-62478229 CGCCTCCGGGAAGTCCGGGCGGG + Intronic
1151662646 17:75526678-75526700 GGGCTCCAGGGACCCCCTGCTGG + Intronic
1151966452 17:77434119-77434141 GGTCTCCAGGAGGCCCTTGGTGG + Intronic
1152225576 17:79091154-79091176 GGCCGCCTCGAAGCCTGTGCTGG - Intronic
1152635077 17:81427537-81427559 GGCCTCCAGGAGTCTCCTGCTGG - Intronic
1152899830 17:82934129-82934151 GGCCCCCAGGAAGCCCCCTCTGG + Intronic
1156471161 18:37378031-37378053 GGCTTCCAGGAGCCTCGTGCTGG + Intronic
1157281674 18:46350387-46350409 CGCCTCCAGGAAGCCCTCCCAGG - Intronic
1157813002 18:50711005-50711027 CTGCTCCAGCAAGCCCGTGCTGG - Intronic
1157820033 18:50760433-50760455 TGCCTCCAGATAGCCCTTGCAGG - Intergenic
1158338076 18:56435027-56435049 GGCCTCCAGGCAGGGCGTGGTGG + Intergenic
1158411017 18:57206253-57206275 GACCACCAGGAAGGCAGTGCTGG + Intergenic
1158905927 18:62011691-62011713 GGCTTCCAGGAAGAGTGTGCTGG + Intergenic
1160548727 18:79679793-79679815 GCCCTCCAGGAAGTCGGCGCGGG + Exonic
1160680684 19:410635-410657 CGCCTCCAGGAAGCCTGGGCAGG + Intergenic
1160710531 19:549136-549158 GGCCGCCAGGCAGACCATGCTGG - Exonic
1160749736 19:728157-728179 GGCCCGCAGGAAGCTCGGGCGGG + Intronic
1160968286 19:1756087-1756109 TGCCCCCAGGCAGCCCGTCCAGG + Intronic
1160975617 19:1790870-1790892 GGCCCCCAGGCAGCCAGTGCGGG - Intronic
1160983454 19:1827100-1827122 CGCCTCCGGGAAGCCCAGGCTGG + Exonic
1161025638 19:2035447-2035469 CGCCTCCAGGAAGCCCTTCCTGG + Intergenic
1161302270 19:3548401-3548423 GGCCTCCAGGAAGCCCGTGCTGG + Intronic
1162017219 19:7852190-7852212 GGCCTCCAGGCAGGCCGGGCTGG - Intronic
1162421246 19:10567292-10567314 GGTGTCCAGGAATCCAGTGCGGG + Exonic
1163614434 19:18318375-18318397 CTCTTCCAGGAAGCCGGTGCAGG - Intronic
1164840473 19:31389146-31389168 GGACTCCACCAAGCCCATGCAGG - Intergenic
1164844859 19:31423381-31423403 GGCTTCCAGGAAGCCCTGGCTGG + Intergenic
1165363772 19:35351826-35351848 GGCGGCCAGGAAGCCCCCGCCGG - Exonic
1166703596 19:44896140-44896162 GGGCTCCAGGAGGCCAGTGCTGG - Intronic
1167276544 19:48543555-48543577 GGCCTCCCTGAAGCCACTGCAGG + Intergenic
1168103639 19:54153893-54153915 AGGCTCCAGGCAGCCCCTGCTGG + Intronic
1168204530 19:54839867-54839889 GGCCTCCATGCAGGCCATGCAGG - Intronic
924990699 2:310378-310400 GAGCTCCAGGAAGCCCCTGTCGG + Intergenic
926238523 2:11067928-11067950 TGCCCCCAGGAATCCCCTGCAGG + Intergenic
926303211 2:11618585-11618607 GGCCTGCAGGACCCACGTGCCGG - Exonic
932415274 2:71569877-71569899 GGCCTCCGGGAAGCCGGGTCTGG - Exonic
934945349 2:98537374-98537396 GGGCTTCAGGAAGCCCTGGCTGG + Intronic
937877298 2:126835445-126835467 GGCCTCCAGCATACCCGTCCGGG - Intergenic
937956589 2:127425139-127425161 GGCTTCCAGGAAGGCAGTGCAGG - Intronic
938650931 2:133382640-133382662 GGCCTCCAAGAAGCCTTTTCAGG + Intronic
942090255 2:172483108-172483130 CTCCTCCAGGAAGCCTGTCCTGG - Intronic
946178979 2:217938629-217938651 GGCCTCCAGGAAGCCTGCCCTGG - Intronic
946366943 2:219254219-219254241 TGCCTCCAGGACGCAGGTGCAGG - Intronic
946373577 2:219294985-219295007 GGCCTCCACGCGGCCCCTGCTGG - Exonic
946913012 2:224485498-224485520 GGCCTCCAGGAAGTTCGAACTGG + Intronic
948514348 2:238494355-238494377 GCTCTCCCGGCAGCCCGTGCAGG + Intergenic
948569313 2:238907376-238907398 GTCCTCCAGGAAGCCGGGGTGGG - Intronic
948728294 2:239947771-239947793 GGGCTCCAGGAAGCACGGGGTGG + Intronic
948902043 2:240960969-240960991 GGCCTCAAGGAAGGGAGTGCAGG + Intronic
1168766992 20:388425-388447 AGCATCCAGGGAGCCCCTGCTGG + Intronic
1169162976 20:3398126-3398148 GGCCTCCAGGATCACCATGCAGG + Intronic
1171206176 20:23283152-23283174 GGCCTCCTGCAAGCCAGTGTTGG + Intergenic
1171290152 20:23978583-23978605 GGCCTCCAGCCAGCCCGGCCAGG + Intergenic
1171484721 20:25478468-25478490 GGCTTACAGAAAGCCTGTGCTGG - Intronic
1173784070 20:45779857-45779879 GGCCTCCAGGAAGCCTGGCCTGG - Intronic
1173790331 20:45824057-45824079 GGCCTCCGGGGAGCACGTGACGG - Exonic
1175696017 20:61103196-61103218 GGCCTGGAGGAAGCCCATGCAGG - Intergenic
1176231668 20:64036185-64036207 GTCCTCCAGGCAGCCTGTCCAGG + Intronic
1176233267 20:64042536-64042558 GGCTGCGAGGAAGCCCGTGTCGG - Intronic
1178493332 21:33067974-33067996 GGCTTCCAGGAAGCCCAGGAGGG - Intergenic
1179543635 21:42100449-42100471 GGCTTTCTGGATGCCCGTGCTGG - Intronic
1179792270 21:43762530-43762552 GTCCTGCAGGAAGCCCATGCCGG - Intergenic
1180157380 21:45984096-45984118 GCCCTCCTGGAAGGCTGTGCAGG - Intronic
1180767282 22:18352447-18352469 GGCCTCCAGCCAGCCCGGCCAGG - Intergenic
1180779027 22:18509932-18509954 GGCCTCCAGCCAGCCCGGCCAGG + Intergenic
1180811748 22:18767252-18767274 GGCCTCCAGCCAGCCCGGCCAGG + Intergenic
1181197901 22:21201494-21201516 GGCCTCCAGCCAGCCCGGCCAGG + Intergenic
1181313093 22:21956052-21956074 GGCCTCCAGGAAGGGGGTCCAGG + Intergenic
1181346200 22:22222124-22222146 GGCCTCCAGGAAGGGGGTCCAGG + Intergenic
1181395270 22:22616781-22616803 GGCCTCCAGGACGCTGCTGCTGG - Intergenic
1181401844 22:22654312-22654334 GGCCTCCAGCCAGCCCGGCCAGG - Intergenic
1181632451 22:24158274-24158296 GGTCTCCAGGAAGCAGGTCCTGG - Intronic
1181703798 22:24635406-24635428 GGCCTCCAGCCAGCCCGGCCAGG - Intergenic
1182109204 22:27710956-27710978 TTCCTCCAGGAAGCCCTTCCTGG + Intergenic
1182249019 22:28984820-28984842 TTCCTCCAGGGTGCCCGTGCAGG - Intronic
1182273343 22:29169751-29169773 GGGCTCCAGGAAGGCAGGGCTGG + Intergenic
1182718506 22:32378626-32378648 GGCCTCCAGGAGGCTGGGGCTGG + Intronic
1183401860 22:37609334-37609356 GGGCTCCAGGAACGCCATGCAGG - Intronic
1183929808 22:41229580-41229602 GGGGTCCAAGAAGCCCCTGCTGG + Exonic
1184036550 22:41920767-41920789 GGCCTGCAGGAAGCCCCAGGAGG + Intergenic
1184226111 22:43129744-43129766 GGGCGAGAGGAAGCCCGTGCTGG - Intergenic
1185171604 22:49297673-49297695 GGCTCCCTGGAAGCCCGTCCGGG - Intergenic
1185419665 22:50728418-50728440 GGGCTCCAGGAGGTCCGAGCTGG - Intergenic
1203228904 22_KI270731v1_random:93341-93363 GGCCTCCAGCCAGCCCGGCCAGG - Intergenic
949837052 3:8280546-8280568 TTCCTCCAGGAAGCCTTTGCTGG + Intergenic
950489763 3:13296765-13296787 GGCAGGAAGGAAGCCCGTGCAGG + Intergenic
950649386 3:14397740-14397762 GGACCCCAGGAAACCCTTGCAGG - Intergenic
950662687 3:14476484-14476506 GGACTCCAGGAACCCCTTCCTGG - Intronic
951868553 3:27334212-27334234 GGCCTGCAGGCAGCACATGCTGG - Intronic
952942561 3:38455054-38455076 GGCCTCCAGGAGGCACGTGGCGG + Intronic
953025598 3:39143160-39143182 GGACTCCAGGAAGCAACTGCTGG + Exonic
954093085 3:48301103-48301125 GCCCTCCAGGAAGCGAGTGGTGG - Intronic
957193733 3:77040971-77040993 TGCCCCCAAGGAGCCCGTGCCGG - Intronic
960014504 3:112871613-112871635 GGCTCCCAGGAAGCTCCTGCTGG + Intergenic
961541941 3:127606155-127606177 GGCAGCCAGGGAGCACGTGCTGG + Exonic
962809151 3:138946849-138946871 GGCCTCCAGCAAGCAAGCGCGGG - Exonic
964591587 3:158368346-158368368 GGCCTCCTGGCAGGCCTTGCAGG + Intronic
966840471 3:184083408-184083430 GGCAACCAGAAAGCCCGTGGGGG - Intergenic
968430822 4:557413-557435 GGCCTCCATGTGTCCCGTGCTGG + Intergenic
968443092 4:634344-634366 GGCATCCAGGAAGCCCGACGTGG + Intronic
968472739 4:789547-789569 GGCCCTCAGAAGGCCCGTGCAGG + Intronic
968969763 4:3787757-3787779 TGCCTCCAGGAAGCCCTTCCTGG - Intergenic
969112595 4:4853017-4853039 TGCCTCCAGGAAGAACTTGCTGG + Intergenic
969296452 4:6273020-6273042 TGCCTCCAGGATGCCAGTCCAGG - Intronic
969700218 4:8763959-8763981 GGCCTCCTTGCAGCCTGTGCGGG - Intergenic
969925711 4:10583949-10583971 TCCCTCCAGGATGCCAGTGCAGG + Intronic
971235974 4:24842742-24842764 GTCCTCCATGAAGCCTGTCCAGG + Intronic
972396743 4:38664394-38664416 GGGCTCCAGGCAGCCCGTATCGG + Exonic
973574530 4:52273610-52273632 GGCCTCCAGCCACCCCTTGCTGG + Intergenic
975623192 4:76315052-76315074 TGTCTCCAGGCAGCCAGTGCAGG - Intronic
977908112 4:102501009-102501031 AGCCCCCAGGAAGCGCCTGCCGG - Intergenic
978559094 4:110012609-110012631 GGCCTCAAGCAAGGTCGTGCTGG + Intergenic
979190438 4:117850042-117850064 GGCCTGCAGGTAGCATGTGCAGG - Intergenic
979259521 4:118634323-118634345 GGCCGCCAGGAGGCCCAAGCTGG - Intergenic
981501618 4:145458003-145458025 GGCCGCCAGGAAGCTCGAACAGG + Intergenic
983552422 4:169031517-169031539 GGCCTCCAGGATGCCCCTCCAGG - Intergenic
983552433 4:169031551-169031573 GGCCTCCAGGATGCCCCTCCAGG - Intergenic
983552444 4:169031585-169031607 GGCCTCCAGGATGCCCCTCCAGG - Intergenic
985493360 5:191783-191805 CGCCTCCAGGCAGGCCCTGCAGG - Exonic
997018300 5:129964080-129964102 GGCATCAAGGAAGTCTGTGCTGG + Intronic
999641787 5:153679840-153679862 GCCCTCCAGGTAGGCTGTGCTGG - Intronic
1001149840 5:169217562-169217584 GGCCCCCAGGAACCCCAGGCTGG - Intronic
1001526600 5:172433579-172433601 GGCCACCAAGGAGCCCCTGCCGG + Intronic
1001680641 5:173554607-173554629 GGCCTCCTGGAAGACTGTGTTGG - Intergenic
1002049314 5:176561001-176561023 GGCCTGCAGCTAGCCAGTGCTGG + Intronic
1002085892 5:176775102-176775124 ATCCTCCAGGAAGCCTGTCCTGG + Intergenic
1002134401 5:177098890-177098912 GGCCTCCATGAAGGCTGTCCTGG - Intergenic
1003162320 6:3646715-3646737 GGACTCCAGGAAGCCTGAGCAGG - Intergenic
1003395878 6:5751630-5751652 GGCCTAGTGGAAGCCTGTGCTGG + Intronic
1005939055 6:30547190-30547212 GGCCTCCCGAATTCCCGTGCAGG - Exonic
1006375908 6:33671483-33671505 GGTCTCCAGGGAGTCCGGGCAGG - Intronic
1006637914 6:35473814-35473836 GACCTTCAGGAAGCTCGGGCAGG + Exonic
1010735300 6:79437184-79437206 GGACTCCAGGGAGCCCGTGGAGG + Intergenic
1011627624 6:89296420-89296442 GGCATCCAGGAAAGCCCTGCAGG + Intronic
1013191289 6:107806281-107806303 CTCCTCCAGGAAGCCTGTACAGG - Intronic
1016783720 6:147988025-147988047 GTCCTCCAGGCAGACCGGGCAGG - Intergenic
1017928744 6:158934014-158934036 GGCCTCCACGAGGCCTGTGCTGG + Intergenic
1018923739 6:168193077-168193099 CGCCTCTAGGAAGCCCCCGCAGG - Intergenic
1019080521 6:169426634-169426656 GGCCTGCAGGAAGCACAGGCTGG - Intergenic
1019174430 6:170153013-170153035 GGCCTCCAGCCAGCCGGTGGGGG - Intergenic
1019282558 7:207764-207786 GGCCTCCAGGTCGCCCGAGATGG - Intronic
1021608761 7:22435778-22435800 GGTCTCCATGAAGCCCATCCAGG - Intronic
1023401249 7:39793956-39793978 GGCCTCCCGGCAGCCTCTGCAGG + Intergenic
1023792998 7:43768777-43768799 GGCCTCCAGGTAGCCAGGGGAGG + Intronic
1023881510 7:44324031-44324053 GCCCTGCAAGAAGCCCATGCTGG - Intronic
1024648364 7:51386725-51386747 GGCCTCCCGGCAGCCTCTGCAGG - Intergenic
1024648896 7:51388798-51388820 GGCCTCCCGGCAGCCTCTGCAGG - Intergenic
1025042854 7:55662906-55662928 GGCCTCCAGGTAGTGTGTGCTGG - Intergenic
1025177594 7:56809915-56809937 GGCCTCCCGGCAGCCTCTGCTGG - Intergenic
1025178219 7:56812493-56812515 GGCCACCATGAGGCCCGAGCTGG + Intergenic
1025695474 7:63772270-63772292 GGCCACCGGGAAGCCGGAGCTGG + Intergenic
1025864265 7:65365673-65365695 TGCCCCCAGGAAGCACCTGCAGG + Intergenic
1026797818 7:73377403-73377425 CGCCTCCGGGAAGCCCGCCCAGG - Intergenic
1028484976 7:91347856-91347878 GGCCAACAGGAAGCCCCTGCTGG - Intergenic
1029714492 7:102318583-102318605 GGCCGCCAGGAAATCCGTCCTGG - Intronic
1030102239 7:105956621-105956643 GGGCTCCAGGAAGCCAATGAAGG + Intronic
1032488126 7:132303776-132303798 GGCCTCCTGGAAGGCGGGGCTGG - Intronic
1032780586 7:135162315-135162337 GGCCTCCTGGAAGCCCCAGCAGG - Intronic
1033412576 7:141132555-141132577 GGCCCCCAGGTGGCACGTGCAGG - Intronic
1034999684 7:155603006-155603028 GCCCTCCAGGATGCCCACGCTGG + Intergenic
1035209039 7:157314222-157314244 GGCCCCCAGGAAGGCAGGGCAGG - Intergenic
1035945135 8:3954069-3954091 CGCCTCTAGGAAGCTCGTGCAGG + Intronic
1036516239 8:9446956-9446978 AGCCTCCAGGAAGCCCAAACTGG - Intergenic
1037696446 8:21228191-21228213 TGCCCCTAGGAAGCCTGTGCTGG - Intergenic
1040550283 8:48432182-48432204 CTCCTCCAGGAAGCCCATCCAGG - Intergenic
1041388186 8:57326548-57326570 AGCCTCCAGGAAGCTCGAACTGG - Intergenic
1042566472 8:70117122-70117144 GGCCACCAGGATGCACGTGAAGG + Intronic
1045298221 8:100890619-100890641 GGCCTCCAGGCTGGGCGTGCTGG - Intergenic
1045335958 8:101205101-101205123 GGCCTCCAGGAGGCGCGTCTTGG - Exonic
1047782360 8:128120406-128120428 GGCTTCCAGTAGGCCAGTGCAGG - Intergenic
1048255301 8:132901002-132901024 TCCCTCCAGGAAGCCTCTGCTGG + Intronic
1048430559 8:134366697-134366719 GGCTTCCAGGAAGCTCAAGCTGG - Intergenic
1049203447 8:141352596-141352618 GGCCTCCAGGAAGCTGGGGCAGG + Intergenic
1049208698 8:141375446-141375468 GGCCTCCAGGAAGACCGCTCAGG - Intergenic
1049719964 8:144111235-144111257 GGCCTCCAGGAGGGCTGAGCAGG - Intronic
1049777457 8:144413282-144413304 GTCCTCCTGGAAGACCGGGCTGG - Exonic
1051164959 9:14251732-14251754 GGTGTGCAGGATGCCCGTGCAGG - Intronic
1052695129 9:31868840-31868862 GGCCTCCAGGCAGCTCATTCAGG + Intergenic
1052766982 9:32651113-32651135 GGCCTCCAGCCACCCCCTGCTGG + Intergenic
1053165817 9:35842797-35842819 CTCCTCCAGGAAGCCTGTCCAGG + Intronic
1054798508 9:69324970-69324992 GGACCCCAGGAAGCCGGCGCAGG + Intronic
1055090973 9:72364761-72364783 GGCCTCCGGGAAGGCTGAGCCGG + Intronic
1057444928 9:95107095-95107117 GGCCTCCAGGAGCCCAGAGCAGG + Exonic
1057911922 9:99026070-99026092 GGCCTCCTGAAATCCCCTGCTGG + Intronic
1059341497 9:113599948-113599970 GTCCTCCAGGGAGCCCAGGCAGG - Intergenic
1059389491 9:113989884-113989906 GGCCTCCTGGCAGCCAGGGCAGG - Intronic
1059941052 9:119360343-119360365 GACCTACAGGAAGCCTGGGCTGG - Intronic
1060389627 9:123267700-123267722 GGCCACCGGGACGCCCGTGAAGG - Intronic
1060547665 9:124470494-124470516 GGCCACGGTGAAGCCCGTGCTGG + Exonic
1060832158 9:126723335-126723357 AGCCTTCAGGGAGCCCGCGCGGG + Intergenic
1061355602 9:130102428-130102450 GCCTTCCAGGAAGCCCGTCCTGG + Intronic
1061423509 9:130484993-130485015 GGCAGCCAGGAAGCCGGTGCTGG + Intronic
1061959385 9:133980248-133980270 GGCCTCGTGCCAGCCCGTGCAGG - Intronic
1062036538 9:134385066-134385088 GGCCTCAAGGAAGGCTGCGCAGG - Intronic
1062236921 9:135514810-135514832 GGGCTCCAGGAAGCCCTCTCTGG - Intergenic
1062315585 9:135965531-135965553 CTCCTCCAGGAAGCCCGCCCTGG + Intergenic
1185683022 X:1904201-1904223 ACACTCCAGGAAGCACGTGCAGG + Intergenic
1189377337 X:40475925-40475947 GTCCTCCAGGAGGCAGGTGCGGG - Intergenic
1191254125 X:58272535-58272557 GGACTCCACGAACCCCGTGATGG + Intergenic
1195826791 X:109010860-109010882 AGCCTCCAGGAAGCTCGAACTGG + Intergenic
1195931490 X:110081840-110081862 TGCCTCCAGGAAGAACATGCTGG - Intronic
1198320720 X:135516564-135516586 GGGCTCCAGGAGGCCCCTTCAGG - Intergenic
1200065553 X:153502719-153502741 GGTCACCAGGAGGCCCCTGCTGG - Intronic
1201504756 Y:14685905-14685927 GCCCTCCAGGAAGCCTGAGGTGG - Intronic