ID: 1161304510

View in Genome Browser
Species Human (GRCh38)
Location 19:3559495-3559517
Sequence TGATTCTCTGCTGCTCCACT TGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 227
Summary {0: 1, 1: 0, 2: 0, 3: 21, 4: 205}

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1161304505_1161304510 23 Left 1161304505 19:3559449-3559471 CCTTGCAGTATGGAAGGAGAATC 0: 1
1: 0
2: 1
3: 16
4: 162
Right 1161304510 19:3559495-3559517 TGATTCTCTGCTGCTCCACTTGG 0: 1
1: 0
2: 0
3: 21
4: 205
1161304508_1161304510 -7 Left 1161304508 19:3559479-3559501 CCAGACTTGGTTCCACTGATTCT 0: 1
1: 0
2: 1
3: 25
4: 211
Right 1161304510 19:3559495-3559517 TGATTCTCTGCTGCTCCACTTGG 0: 1
1: 0
2: 0
3: 21
4: 205

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1161304510 Original CRISPR TGATTCTCTGCTGCTCCACT TGG Intronic
901074697 1:6546517-6546539 TGATTATTTCCTGCTGCACTGGG - Intronic
903759373 1:25687172-25687194 TGATGTGCGGCTGCTCCACTTGG - Intronic
904305081 1:29583573-29583595 TAGATCTCTGCTGCTCCAGTTGG - Intergenic
904734634 1:32621597-32621619 TGATTCTCTGCTGTGGCAGTAGG - Exonic
904906404 1:33900346-33900368 TCTTTCTCTTCTGCTCCTCTGGG - Intronic
905861341 1:41354016-41354038 CACTTCTCTGCTGCTCCTCTGGG - Intergenic
907372854 1:54014296-54014318 TGCCTCTCTGCTGCTCCTCCTGG - Exonic
908066125 1:60406854-60406876 TTATTCTCTGAAGCTCAACTCGG + Intergenic
910454392 1:87381338-87381360 TGTTCCTCTCCTGCTCCAATAGG + Intergenic
912520070 1:110239171-110239193 TGATGCCCTGCTGCTCCTCATGG + Intronic
913255555 1:116950125-116950147 AGCTACTCTGCTCCTCCACTGGG - Intronic
915740933 1:158117956-158117978 GGATTCTCTGCAGCTCCCCCTGG - Intergenic
917767440 1:178237225-178237247 TGATTCTGTGCTCCTCCATTTGG + Intronic
919089082 1:192956520-192956542 GGATTCTCTACTTCTCTACTAGG - Intergenic
920828599 1:209445667-209445689 TGATACTCAGATGATCCACTTGG - Intergenic
921992433 1:221381916-221381938 TGATTCTCTGCTTCTCTTCAAGG + Intergenic
924685823 1:246288575-246288597 TGATTCTCTTCTGCCCCAGGTGG - Intronic
1065376093 10:25043685-25043707 CGATTCTCTTCTGTTCTACTGGG + Intronic
1066363488 10:34753760-34753782 TGATTCTCTGCTTCTCTCCATGG - Intronic
1067466384 10:46502095-46502117 TGATTCTCTGTTGCCCCACAGGG + Intergenic
1067562798 10:47315525-47315547 TGTTTTTCTGCAGCTCCAATTGG - Intergenic
1067568191 10:47352994-47353016 TGTCTCTAAGCTGCTCCACTGGG - Intronic
1067620804 10:47882510-47882532 TGATTCTCTGTTGCCCCACAGGG - Intergenic
1067712870 10:48664267-48664289 GGATTCTCTGTGGGTCCACTGGG + Intergenic
1067741763 10:48900968-48900990 TGGTTATGTGCTGCTCCACATGG + Intronic
1067962587 10:50872736-50872758 GGATTGTCTGATGCTTCACTCGG + Intronic
1070796367 10:79219237-79219259 TGAGTCTCTCCTGCTCCTCTGGG - Intronic
1071850394 10:89563061-89563083 TGATTCTCTGCAAGACCACTTGG + Intergenic
1073741178 10:106408821-106408843 GGATTCTCTGCAGATCCTCTGGG - Intergenic
1075226270 10:120632339-120632361 TGAGAGTTTGCTGCTCCACTAGG + Intergenic
1077555319 11:3223220-3223242 TGAGTGCGTGCTGCTCCACTGGG + Intergenic
1078320492 11:10330195-10330217 TGATTCACTGATGAACCACTTGG + Intronic
1078361825 11:10675128-10675150 TAATTCACTGCTGCTCCAAATGG - Intronic
1078663814 11:13308004-13308026 TGCTTCCCTGCTGCTACTCTTGG - Intronic
1079802801 11:24892043-24892065 TGGTTGGCTGCTGTTCCACTGGG + Intronic
1080213821 11:29818110-29818132 TCATCCTCTGCTCCGCCACTAGG - Intergenic
1080583527 11:33662499-33662521 TCATTCTCTGCTATTCCACATGG + Intronic
1081075964 11:38673937-38673959 AGATTTTCTGCTGCTACAATTGG - Intergenic
1083262805 11:61532323-61532345 TGACTCACTGCTGCCCCCCTGGG + Intronic
1083800999 11:65046195-65046217 TGATGCTGTGCTGCTCCAGCAGG + Exonic
1084050418 11:66595852-66595874 TGATTCTCTGCTCCTGAAGTGGG - Intronic
1085058690 11:73424796-73424818 TGATCCTTTGCTGCTGCCCTAGG + Intronic
1085248630 11:75125919-75125941 TGCTCCTCTGCTCCTCCATTTGG - Intronic
1088831447 11:113540232-113540254 TGCTTCTCTGCTTCTCCTCTGGG - Intergenic
1095944697 12:47747177-47747199 TGAATCTCAGCTGCTCCCGTGGG + Intronic
1097234987 12:57533336-57533358 TGCTTCCCTGCTGCTGCAATGGG + Intronic
1097572503 12:61351989-61352011 TTTTTCTCTGCTGCTACAATGGG + Intergenic
1100783907 12:98058927-98058949 TGATTACCTTCTGTTCCACTGGG + Intergenic
1101585241 12:106080121-106080143 TGACTCTCAGCTGCCCCACTTGG + Intronic
1102912350 12:116726636-116726658 TCATACTCTTCTGCTCTACTGGG + Intronic
1105958031 13:25301983-25302005 TGCTTCTCTCCAGCCCCACTGGG - Intronic
1108025358 13:46171637-46171659 GGATTCTCTGCTGTTCATCTTGG - Intronic
1108641496 13:52386565-52386587 ATATTCTGTGCTACTCCACTAGG - Intronic
1110238980 13:73245892-73245914 TGATTTTCTGCTACTGCACATGG + Intergenic
1112033212 13:95475530-95475552 GGCTTCTCTGCTGCTCCCCAAGG + Intronic
1114334061 14:21669641-21669663 TGAGTTTCTGTTGATCCACTTGG + Intergenic
1114578855 14:23737800-23737822 TGATTCTCTGGTATTTCACTTGG + Intergenic
1115446226 14:33493382-33493404 TGTCTCTGTGCTGCTCCTCTGGG + Intronic
1116999186 14:51354951-51354973 TGATGCTCTGCTGCTGGCCTTGG + Intergenic
1118681948 14:68250848-68250870 TGCATCACTGCTGCTGCACTGGG - Intronic
1119592069 14:75899296-75899318 TGATTCTTTGCTGCTTTCCTAGG - Intronic
1119781377 14:77278582-77278604 TGACTCTCTGCTCCTTGACTTGG - Intronic
1121475456 14:94197143-94197165 TGTTCCTCTGCTGCTCAATTTGG + Intronic
1121532050 14:94661608-94661630 TGGTGCTCTGTGGCTCCACTAGG + Intergenic
1121658897 14:95620120-95620142 TGAGTCCCTGTTGCGCCACTTGG - Intergenic
1121729957 14:96179662-96179684 TGATTATCACCTGCCCCACTGGG + Intergenic
1126780294 15:52133906-52133928 GGACTCTCGGCTGCTCCATTTGG - Intronic
1127341855 15:58054205-58054227 TGCTTCTCTTCTGCTTCCCTTGG - Intronic
1128307080 15:66605749-66605771 TGAGGCTCTGCTGCACCCCTTGG + Intronic
1130121199 15:81049086-81049108 GGATTCTCTTGTTCTCCACTCGG - Intronic
1130806261 15:87326762-87326784 TCTTTCTATGGTGCTCCACTGGG + Intergenic
1132283913 15:100645455-100645477 TTATTATCTGCTCCTCCACTCGG + Intronic
1132353899 15:101157659-101157681 TTATTTTCTGCTTCTCCACGGGG + Intergenic
1134107503 16:11494513-11494535 TGATTCGCTTCGGCCCCACTGGG + Intronic
1137717674 16:50608637-50608659 TGAAACTCTGCTGCTCCTCTGGG + Intronic
1138446100 16:57065157-57065179 TGATTGTCTGCTGCTCACCTTGG + Intronic
1139049235 16:63102827-63102849 TGAGTCTCTGCTGCTACAGTTGG - Intergenic
1140192598 16:72830681-72830703 TTATTCTCTTCTTCCCCACTTGG - Intronic
1140848797 16:78914944-78914966 TGATTCTCTGTCTCTCCACCAGG - Intronic
1141376755 16:83538158-83538180 TGATTTTCTCCTGAGCCACTCGG - Intronic
1142945449 17:3422652-3422674 TGATTCTCTCCAGCCCCTCTAGG + Intergenic
1143362240 17:6381697-6381719 TTTTTCTCTGCTGATGCACTGGG - Intergenic
1143473104 17:7188444-7188466 TGATTCTCAGGTGCTCCAGTGGG - Intergenic
1146270207 17:31480150-31480172 TGTTTCTCCACTGCTCCACACGG + Intronic
1149313934 17:55421696-55421718 TGATCCTCTGCTCCTCCTCGGGG + Exonic
1151306230 17:73264236-73264258 AGCTTCTCTGCTCCTCCACCAGG + Intergenic
1152550391 17:81026917-81026939 TGACACTGGGCTGCTCCACTGGG + Intergenic
1156204476 18:34871150-34871172 TAATTCTCTGCTGTTTCACCAGG + Intronic
1157213836 18:45765398-45765420 TAATTCTCTCCTACTCCACCTGG - Intergenic
1158350178 18:56557212-56557234 CTACTCTCTGCTGCTGCACTTGG + Intergenic
1160300912 18:77677532-77677554 TGATTCTCTGCACATTCACTCGG - Intergenic
1161304510 19:3559495-3559517 TGATTCTCTGCTGCTCCACTTGG + Intronic
1164742872 19:30589715-30589737 AGCTTCCTTGCTGCTCCACTGGG - Intronic
1165902580 19:39175577-39175599 TGACTCTGGGCTGCTCCACCAGG - Intronic
1166955279 19:46460078-46460100 TGCTTCTGAGCTGCTCCTCTAGG - Intergenic
1166957678 19:46475847-46475869 TGATTCTGTGCTCATGCACTGGG - Intergenic
1167051129 19:47079431-47079453 TGATTCTGTGGTGCTCCTGTGGG + Intronic
1168102665 19:54149307-54149329 GGATTCTCGGGTGCTCCACCAGG - Intronic
1168476821 19:56681991-56682013 TGAGTCTCTGCAGCTACATTTGG - Intergenic
1168483451 19:56740849-56740871 TTATTCTCTGCAGCTGCATTTGG - Intergenic
925740036 2:6997007-6997029 TGGTTGTCATCTGCTCCACTGGG - Exonic
926534717 2:14096969-14096991 ATATTCTCTGCTGCTATACTTGG + Intergenic
927125585 2:20010320-20010342 TGATTCTTTCCTTCTCCACTTGG + Intronic
929671916 2:43882735-43882757 CCATTCTCTGCTGGTGCACTAGG + Intergenic
932619815 2:73258814-73258836 TGTTGCTCTGCTGCTCCAGGAGG + Exonic
933252981 2:80049665-80049687 AGAATGTCTGCTGCTCCACTGGG + Intronic
936625978 2:114149876-114149898 TGATTCTCTGTGGCTCCACCTGG + Intergenic
937267394 2:120625158-120625180 TGATTCTCTGCTGCAGCACGGGG - Intergenic
937504829 2:122525442-122525464 TGATCATCTGCAGCTGCACTGGG - Intergenic
938306985 2:130263274-130263296 TCAGTCCTTGCTGCTCCACTGGG + Intergenic
938764702 2:134452811-134452833 AGATGCTCTGCAGCTCCACAGGG - Exonic
941452398 2:165675375-165675397 TAATTCTATGCTGCTCCTCAGGG + Intronic
941921068 2:170851209-170851231 TGATTCTTTGCTGCTACAAAAGG - Intronic
942251582 2:174051824-174051846 CTGTTCTCTGCTGCTCCTCTTGG + Intergenic
942521427 2:176808333-176808355 TGATTATTTGTTGCTGCACTTGG + Intergenic
944882856 2:204032124-204032146 TGCTTCTCTGCTGGTCACCTTGG - Intergenic
946149065 2:217751868-217751890 TGGCTCTGTGCTGCTCCTCTTGG + Intronic
947599035 2:231433666-231433688 TGATTCTCTGCTGTGGCAGTAGG - Intergenic
1169738960 20:8868962-8868984 TGATTCTGCGCTGAACCACTTGG + Intronic
1175085162 20:56452190-56452212 TGGTGTTCTGCTGTTCCACTCGG - Exonic
1179269301 21:39838067-39838089 TGATACTGTGCTGCTCTGCTGGG - Intergenic
1179816006 21:43906791-43906813 TCATTCCATGCTGCTCCCCTGGG - Intronic
1180204530 21:46249934-46249956 TGTGTCCCTGCTCCTCCACTTGG - Intronic
1182014317 22:27026281-27026303 TTAGTCTCTGCTCCTCCACAGGG - Intergenic
1182976539 22:34627624-34627646 TGATTATGTGGTGCTCAACTAGG - Intergenic
1183258645 22:36779705-36779727 TGATCATCTGCCGCTCCACTGGG - Intergenic
1183499475 22:38169747-38169769 TGAGTCTCTGCTGGGACACTGGG - Intronic
952034486 3:29183023-29183045 TGGTTGGCTGCTGTTCCACTGGG - Intergenic
952559583 3:34575730-34575752 AGTTTCTCTTCTGGTCCACTGGG - Intergenic
952919043 3:38272079-38272101 TCAGTCTCTGCTGCTGCACAAGG + Intronic
953217909 3:40938304-40938326 GGATGCTCTACTACTCCACTGGG + Intergenic
953575886 3:44112863-44112885 TGATTCTCTGCTGGGACATTAGG - Intergenic
953682189 3:45047858-45047880 TGGTTCTCAGCTTCTCAACTGGG - Intergenic
953964625 3:47294373-47294395 TTATTGTCTGCTACTCCACTAGG - Intronic
954602584 3:51881099-51881121 AGATGCACTGCTGCTACACTAGG - Intergenic
954984743 3:54779698-54779720 TGCTGCTCTGCTTCTCTACTGGG + Intronic
955494703 3:59519390-59519412 TGATCCTTTGCTACTCCGCTGGG + Intergenic
957531927 3:81451608-81451630 TGATTCTCTGGAGCTTCAGTTGG - Intergenic
958822350 3:98989900-98989922 TCATTGTCTCATGCTCCACTAGG - Intergenic
960387336 3:117035985-117036007 TGCCTCTCTGCTCCTCCCCTGGG - Intronic
960676386 3:120199510-120199532 TAATTTTCTCCTGCACCACTCGG - Intronic
961352735 3:126314426-126314448 TGATTCTCTGCTTCCCCAAGCGG - Intergenic
963008758 3:140750215-140750237 TTATTCACTGCTGCTCCCCAGGG - Intergenic
964160994 3:153644976-153644998 TGATTCTCTGCTTGGTCACTTGG - Intergenic
965955124 3:174360498-174360520 TGATGGTATGCTGCTCCCCTTGG - Intergenic
966207504 3:177420014-177420036 TTATTCTCTCCTCCTCCAGTGGG - Intergenic
966736053 3:183188040-183188062 TGATGCTCAGGTGATCCACTAGG + Intronic
967254050 3:187571822-187571844 TGATGCTCTGCTGCCCCTCCGGG + Intergenic
967780614 3:193435647-193435669 TGGTGTTCTGCTGCTCTACTGGG - Exonic
969451566 4:7276795-7276817 GGAAGCTCTTCTGCTCCACTAGG - Intronic
969860870 4:10034383-10034405 TGATTCCATGCTGCTCCCCCAGG - Intronic
971260691 4:25054182-25054204 TCATTCACTGCTGCACCCCTGGG - Intergenic
976249829 4:83039139-83039161 TGGTTCTTTTCTGCTCCACGTGG + Intronic
976348793 4:84036317-84036339 TGATTCCCTACTGCACCACCAGG - Intergenic
979006140 4:115299565-115299587 TGCTAATCTGCTTCTCCACTTGG + Intergenic
982753361 4:159189935-159189957 TCAATCTTTTCTGCTCCACTAGG - Intronic
985025204 4:185733458-185733480 TGCTTCTCTGGAGCCCCACTGGG + Intronic
985599757 5:821158-821180 TGGCTCTCTGCTGCTCCCCCCGG + Intronic
987834113 5:23139596-23139618 TTATTTTCTGCTGTTCCTCTTGG - Intergenic
988280324 5:29137392-29137414 GGGTCCTATGCTGCTCCACTGGG - Intergenic
989510250 5:42278389-42278411 TGATTCTTTGTTGCTTTACTGGG + Intergenic
989730059 5:44638414-44638436 GGATTCTTTGCTGCTCCGTTGGG - Intergenic
992746995 5:79829905-79829927 TGTTTACCTGCTTCTCCACTGGG + Intergenic
993207164 5:84896040-84896062 AGATTCTCTCTTGCTCCACAGGG + Intergenic
993515815 5:88833687-88833709 TGATTTTCAGCAGCTGCACTGGG - Intronic
993534265 5:89062145-89062167 TTTTTTTCTGCTGCTCCACAAGG + Intergenic
995042459 5:107604781-107604803 TGATTCTGATCTGCCCCACTAGG + Intronic
995683650 5:114747125-114747147 TGGTACACTGCTGCTCCTCTGGG - Intergenic
996091147 5:119353344-119353366 TGATTCTCTAGGGCTCCCCTTGG - Intronic
998068324 5:139176906-139176928 AGAATCTCAGCTTCTCCACTTGG - Intronic
998891476 5:146750931-146750953 TGTCTCTCTGCTGCTCCAGCTGG - Intronic
999061478 5:148640179-148640201 GGATACTCTGTTGCTCCAGTGGG - Intronic
1003712250 6:8605182-8605204 TGTTTCTCTGATGCTCCTCCTGG + Intergenic
1004243695 6:13952196-13952218 TGATTCAGTGTTGCTGCACTGGG - Intronic
1005915114 6:30344917-30344939 AGATCCTCACCTGCTCCACTAGG + Intronic
1006115284 6:31773002-31773024 TGCCTCTCCGCTGCTCCACAAGG + Exonic
1006813712 6:36837355-36837377 AGAATCTCTGCTTCACCACTTGG - Intronic
1007821576 6:44564264-44564286 TGATTCTGTGATTTTCCACTAGG + Intergenic
1007840475 6:44712114-44712136 GGATTCCCTGCTGCTCCTTTGGG + Intergenic
1008720208 6:54339827-54339849 TCATTCTCTGTTGCTTCATTTGG + Intronic
1010813260 6:80324567-80324589 TGAGTCTCAGCTACTCCCCTAGG + Intronic
1011398369 6:86934455-86934477 GGATTGTCTGCAGCTCCATTTGG - Intergenic
1013909532 6:115257310-115257332 TGACTCTCTCCTTTTCCACTTGG - Intergenic
1014848330 6:126308057-126308079 TGTGTCTCTCCTGCTCCACCGGG - Intergenic
1016539524 6:145148653-145148675 AGATTTTCTTCTGCTCCACCTGG + Intergenic
1018297902 6:162368852-162368874 TGTGTCTCTGCTGCTCCCTTAGG + Intronic
1019292266 7:256571-256593 TGTTTCTCTTCTGCTCCTCATGG + Intronic
1020698906 7:11452584-11452606 TCAGTCTCAGCTACTCCACTGGG - Intronic
1021995362 7:26174626-26174648 TGATGTTCTGCTGGTCCACTTGG - Intronic
1022298845 7:29083475-29083497 TGAATCTCAGATGATCCACTTGG - Intronic
1022719331 7:32928738-32928760 GGATTCTCTCCTGCTTCCCTAGG + Intergenic
1022738577 7:33099479-33099501 GGATTCTCTCCTGCTCCCCTTGG + Intronic
1024146617 7:46523423-46523445 TGATTCAGTGCTGCTGCAATGGG + Intergenic
1027691777 7:81355553-81355575 TGCTTCTCTGGTGCTACACCTGG - Intergenic
1028857671 7:95610108-95610130 TGTTGCTCAGCTGCTCCAGTGGG - Intergenic
1029799459 7:102931036-102931058 GGGTTCACTGCTGCTCCTCTAGG - Intronic
1031111791 7:117619651-117619673 GGTTTATCTGCTGCTTCACTTGG - Intronic
1032285217 7:130534527-130534549 TAATCCTATGATGCTCCACTAGG - Intronic
1032352050 7:131173761-131173783 TGACTCGGTGCTGCTCCACGAGG + Intronic
1033078066 7:138268047-138268069 GGCTTCTCTGCTGCTGCTCTGGG - Intergenic
1033406726 7:141076543-141076565 TGATTCCCTGTTGCTCTGCTTGG + Intronic
1033848896 7:145470039-145470061 TGCTTCTCTCCTGTTTCACTTGG - Intergenic
1034863068 7:154616602-154616624 TGATTCTCTGGTGACCCCCTTGG - Intronic
1038418261 8:27413634-27413656 TGCTTACCTGCTGCACCACTAGG + Intronic
1041483508 8:58348927-58348949 TCATTCTCTTCTACTCCATTGGG - Intergenic
1041985291 8:63915584-63915606 TGCTTTTCTTCTGCTCTACTTGG - Intergenic
1042006073 8:64182014-64182036 TCAATCACTGCTGCTCCACCTGG - Intergenic
1045066502 8:98451636-98451658 TGGTTCTCTGCTTCCCCTCTTGG + Intronic
1045264371 8:100606689-100606711 TGACTCTAAGCTGCTACACTGGG - Intronic
1047785823 8:128153134-128153156 TGACTCAATGCTGCTCCACACGG + Intergenic
1048668582 8:136691694-136691716 TAATGCTCTGCTGCTCCAACAGG - Intergenic
1051212688 9:14761698-14761720 TCATCCCCTGCTGTTCCACTTGG + Intronic
1053102386 9:35381721-35381743 TGAGTCTCTGCTGCGGCACCGGG + Intronic
1053729564 9:41039512-41039534 TTATTCTCCCCTGCTCCATTTGG - Intergenic
1054698943 9:68392550-68392572 TTATTCTCCCCTGCTCCATTTGG + Intronic
1056673486 9:88652284-88652306 TGAGTGTCTGCTTCTCCCCTGGG + Intergenic
1058180253 9:101789914-101789936 TTCTTCTCTGCTGGTCCCCTTGG + Intergenic
1058752574 9:108053419-108053441 TTATTCTCCTCTGCTCCATTTGG - Intergenic
1061044430 9:128157163-128157185 TGATTCTCAGCTGGACCCCTGGG + Intergenic
1062429331 9:136520016-136520038 TGAATCTCTGCAGCTTCCCTGGG - Intronic
1062571417 9:137187419-137187441 TGGTTCCCCGCTGCTCCCCTGGG - Intronic
1187319563 X:18227582-18227604 TGCTGCTCTGCAGCTCCTCTGGG - Intergenic
1188023091 X:25179919-25179941 AGATTTTCTGGTGCTCCCCTAGG + Intergenic
1188222452 X:27557945-27557967 AGAGTCTCTGCTGCTACACTGGG + Intergenic
1191164083 X:57368418-57368440 TGCTTGTCTGCTGTTCCCCTTGG - Intronic
1195431200 X:104791299-104791321 TGGCTCTCTGCTTATCCACTAGG - Intronic
1196168491 X:112561626-112561648 TACTTCTCTGCTTCTCCACTGGG + Intergenic