ID: 1161306604

View in Genome Browser
Species Human (GRCh38)
Location 19:3572552-3572574
Sequence GGCCCCGCCCCGGTTGCCAT GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 88
Summary {0: 1, 1: 0, 2: 2, 3: 5, 4: 80}

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1161306604_1161306616 13 Left 1161306604 19:3572552-3572574 CCCATGGCAACCGGGGCGGGGCC 0: 1
1: 0
2: 2
3: 5
4: 80
Right 1161306616 19:3572588-3572610 CCGGTCGCCCCATCCGGCAGCGG 0: 1
1: 0
2: 0
3: 7
4: 127
1161306604_1161306608 -6 Left 1161306604 19:3572552-3572574 CCCATGGCAACCGGGGCGGGGCC 0: 1
1: 0
2: 2
3: 5
4: 80
Right 1161306608 19:3572569-3572591 GGGGCCCGACCCGGATCCGCCGG 0: 1
1: 0
2: 0
3: 4
4: 78
1161306604_1161306617 17 Left 1161306604 19:3572552-3572574 CCCATGGCAACCGGGGCGGGGCC 0: 1
1: 0
2: 2
3: 5
4: 80
Right 1161306617 19:3572592-3572614 TCGCCCCATCCGGCAGCGGCTGG 0: 1
1: 0
2: 0
3: 5
4: 79
1161306604_1161306618 18 Left 1161306604 19:3572552-3572574 CCCATGGCAACCGGGGCGGGGCC 0: 1
1: 0
2: 2
3: 5
4: 80
Right 1161306618 19:3572593-3572615 CGCCCCATCCGGCAGCGGCTGGG 0: 1
1: 0
2: 0
3: 4
4: 115
1161306604_1161306613 7 Left 1161306604 19:3572552-3572574 CCCATGGCAACCGGGGCGGGGCC 0: 1
1: 0
2: 2
3: 5
4: 80
Right 1161306613 19:3572582-3572604 GATCCGCCGGTCGCCCCATCCGG 0: 1
1: 0
2: 0
3: 0
4: 50

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1161306604 Original CRISPR GGCCCCGCCCCGGTTGCCAT GGG (reversed) Intronic
909971944 1:82001512-82001534 GGCCCGGGCCTGGTGGCCATAGG - Intergenic
914824685 1:151132589-151132611 GGCGCGGCCCCGGTAGCCCTCGG + Exonic
923541147 1:234889046-234889068 GGCCAGCCCCTGGTTGCCATGGG - Intergenic
924464115 1:244284851-244284873 GGCCCCGGCGCCTTTGCCATTGG + Intergenic
1064354677 10:14605910-14605932 GGCACCGCCACTGTTGCCTTTGG + Intronic
1065871240 10:29958028-29958050 GGCCCCTGCCAGGCTGCCATGGG - Intergenic
1072607698 10:96998406-96998428 AGCCCCGGCCCTGTTGCCAGTGG + Exonic
1072695816 10:97601996-97602018 GGCCGCGCCCCCGCTGCCACTGG - Intronic
1072983013 10:100115333-100115355 AGCCCCGGCCCGGCTGCCGTCGG + Intergenic
1075635848 10:124029753-124029775 GGCCCCGCCCCGGTGTGCAGTGG - Intronic
1075802426 10:125161260-125161282 GGCCCCGCCCGGGAGGCCCTCGG + Intergenic
1076761249 10:132606795-132606817 GGCCCTGCCCCCGCTCCCATCGG - Intronic
1077107744 11:849361-849383 GGCTCCGCCCCGGGCGCCCTTGG - Intronic
1079296659 11:19241092-19241114 GGCCCCGCCCCTGGCGCCGTCGG - Intronic
1083774541 11:64888025-64888047 GGCCCCGCCCCGCTTGGGAGGGG + Intronic
1083775528 11:64892861-64892883 GGCCCTGCCCCCTTTGCCAGTGG + Intergenic
1092333656 12:7608627-7608649 GGCAGCGCACCGGTTGGCATGGG - Intergenic
1102352478 12:112204312-112204334 GGCCCCACCAGGGTTGCCCTAGG + Intronic
1103602820 12:122064916-122064938 GGCCCTCCCCTGGTTGCCTTGGG + Intergenic
1119879111 14:78086230-78086252 GTCCTCGCCCTGCTTGCCATGGG + Intergenic
1122220861 14:100238661-100238683 CGCCCCGCCCCCGGTCCCATCGG + Intronic
1123995371 15:25714294-25714316 GGCCCCACCCTGGTTCCCACAGG + Intronic
1132586078 16:706173-706195 GGTGCCGCCCCGGTCCCCATAGG - Intronic
1132667533 16:1089076-1089098 GGCCCTGGCCCGGCTGCCCTGGG - Intergenic
1133269093 16:4601940-4601962 CCCCCGGCCCCGGTGGCCATCGG + Intergenic
1136478567 16:30527371-30527393 AGCCCCGCCCCGGCTCCCAGAGG + Intronic
1141130275 16:81431823-81431845 GGCTCCACTCCGGGTGCCATGGG - Intergenic
1151919261 17:77141230-77141252 TCCCCAGCCCCGGCTGCCATCGG + Intronic
1152644401 17:81462082-81462104 GAGCCCGCCCCGGTTTCCTTGGG - Intronic
1154502354 18:15003149-15003171 GCCCCGGCCCAGGCTGCCATGGG - Intergenic
1158976855 18:62716948-62716970 GGCCCCGCCCGGGCTGTCAATGG - Exonic
1161306604 19:3572552-3572574 GGCCCCGCCCCGGTTGCCATGGG - Intronic
1161560227 19:4969051-4969073 AGCTCCGCCCCGACTGCCATTGG - Intergenic
1161613688 19:5257882-5257904 GGCCCCTCCCCGGTCGCGGTGGG - Intronic
1161724912 19:5923161-5923183 GGCCCCTCCTCGGTGGCCCTGGG - Intronic
1162033242 19:7926162-7926184 GGCCCCGCCCCCGTCGCCATAGG - Exonic
1162464428 19:10831596-10831618 GGCCCAGCCTCGGCTGCCAGAGG + Exonic
1162742766 19:12782885-12782907 ACCCCCCCCCCAGTTGCCATGGG + Intronic
1167293189 19:48635603-48635625 GCCCCCGCCCGGGCTGCCCTCGG - Exonic
1167593373 19:50415950-50415972 GGCCACACCCAGGCTGCCATGGG - Intronic
1168078083 19:53991507-53991529 CGCCCGGCGCCTGTTGCCATAGG - Intergenic
932722484 2:74147996-74148018 GGCCCCGCCCCGGAGGCCTCCGG + Intergenic
938092013 2:128440498-128440520 GGCCCCACCCAGATGGCCATGGG + Intergenic
940971973 2:159904797-159904819 GGCCCCGCCCCCGCCGCCCTCGG + Intergenic
945466059 2:210171438-210171460 TGCCCCTCCCCCGTTGCCATTGG - Intergenic
947518703 2:230828357-230828379 GGCTCCACCCGGGTGGCCATCGG - Intergenic
949017137 2:241719898-241719920 GGCCCCGCAACTGTCGCCATCGG - Intronic
1169939410 20:10920382-10920404 GGCCCCGTCCCTGGTGCCACTGG + Intergenic
1171346246 20:24468901-24468923 GGGCCCGCCCCAGTTGGAATTGG - Intergenic
1172977553 20:38918329-38918351 GGCCACGCCAGGGTTGCCATAGG - Exonic
1175861135 20:62151093-62151115 GGCCCCACACAGGTTGTCATTGG + Intronic
1179518389 21:41925706-41925728 GGCCCTGCCACTGTTGGCATGGG - Intronic
1179906869 21:44427130-44427152 GGCCCCGCCCCGTCAGCCTTTGG + Intronic
1180110070 21:45643438-45643460 GGCCCCGCCCCGCGCGTCATTGG + Intergenic
1180228353 21:46411798-46411820 GGCGCCGCCCCGGCTGCCAGGGG - Exonic
1180956730 22:19744568-19744590 GGACCCTCCCCGGTTTCCAGTGG - Intergenic
1181064607 22:20299541-20299563 GGCCCCGCCCCGCCCGCCGTAGG - Intergenic
1181283502 22:21736065-21736087 GGCCCCGCCCCCGTGTCCCTCGG - Intergenic
1183503571 22:38195935-38195957 GGCCCTGCCCGGTTTGCCTTAGG + Intronic
1184391199 22:44204638-44204660 GGCCCCTGGCGGGTTGCCATGGG + Intronic
1185046828 22:48532792-48532814 GCCCCTGCCCCGGCTCCCATCGG + Intronic
950578902 3:13850337-13850359 GGCTCCGCCCCAGCTGCCAGGGG + Intronic
953761372 3:45689651-45689673 GGCCTCGCCCGAGTAGCCATAGG + Intronic
968661996 4:1802479-1802501 GGCCCCCACCCGGCAGCCATGGG - Intronic
969393985 4:6909289-6909311 GGCCCCGCCGCGGTGGTCTTGGG - Intronic
1002319002 5:178364078-178364100 GGTCCCGCCCCGGGTCACATGGG + Intronic
1006079706 6:31558285-31558307 GGCCCGGCCCTGGTTGGCTTGGG - Exonic
1006347923 6:33498128-33498150 GGCCCCAACCCGGTTCCCACTGG - Intergenic
1007393813 6:41565840-41565862 GGCCCCGCCGCTGCTGCCATCGG - Exonic
1021106734 7:16646348-16646370 CGCCCCGCCGGGGTTTCCATCGG + Intronic
1022094508 7:27130410-27130432 GGCGCCGCCGCGGTAGCCATAGG + Exonic
1022508707 7:30922177-30922199 GGCTCAGCCCCCCTTGCCATCGG + Exonic
1032474918 7:132205048-132205070 GGCCTTGGCCCGGGTGCCATTGG - Intronic
1032766603 7:134999963-134999985 GGCACAGCCCAGGTGGCCATAGG + Intronic
1036698336 8:10993889-10993911 GGCCCTACCCTGATTGCCATGGG - Intronic
1044685587 8:94823149-94823171 CGCCTCCTCCCGGTTGCCATAGG - Intronic
1049374862 8:142284556-142284578 GGGCCCGCCCCAGGTTCCATGGG - Intronic
1049632165 8:143664701-143664723 GGCCCTGCGCCGGTGGCCTTGGG + Intergenic
1057918062 9:99072664-99072686 GGCCACGTCCAGGTTGCCAGGGG - Intergenic
1061625857 9:131840370-131840392 GGCCCCGCCCTGGCTGCTAAGGG + Intergenic
1061922052 9:133787807-133787829 GGCCCCGCCCCAGCAGCCACAGG + Intronic
1061927204 9:133811805-133811827 ACCCCCGCCCGTGTTGCCATGGG - Intronic
1062208078 9:135348253-135348275 AGCCCCGCCCCGGTTGTCATGGG + Intergenic
1062314776 9:135961276-135961298 CGCCCCGCCCCGGCTCCCGTCGG + Exonic
1192528417 X:71867415-71867437 GGCACTGCCCCGGGGGCCATGGG - Intergenic
1199981111 X:152920968-152920990 GGCCCAGCCCCATTAGCCATTGG - Intronic
1200122280 X:153796821-153796843 CAGCCCACCCCGGTTGCCATTGG + Intronic
1201468307 Y:14309296-14309318 GGCGCAGCCCCGGTTCCCACTGG - Intergenic