ID: 1161306710

View in Genome Browser
Species Human (GRCh38)
Location 19:3572922-3572944
Sequence CGCCCGCAGCCCGCCCCCGT CGG (reversed)
Strand -
Crispr in exon? Yes
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 202
Summary {0: 1, 1: 0, 2: 2, 3: 24, 4: 175}

Found 7 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1161306710_1161306716 6 Left 1161306710 19:3572922-3572944 CCGACGGGGGCGGGCTGCGGGCG 0: 1
1: 0
2: 2
3: 24
4: 175
Right 1161306716 19:3572951-3572973 TGGAGCGTCGCGCAGTCGGGAGG 0: 1
1: 0
2: 0
3: 1
4: 30
1161306710_1161306719 25 Left 1161306710 19:3572922-3572944 CCGACGGGGGCGGGCTGCGGGCG 0: 1
1: 0
2: 2
3: 24
4: 175
Right 1161306719 19:3572970-3572992 GAGGTCCGGGAAAGTTTCTTTGG 0: 1
1: 0
2: 1
3: 9
4: 116
1161306710_1161306718 12 Left 1161306710 19:3572922-3572944 CCGACGGGGGCGGGCTGCGGGCG 0: 1
1: 0
2: 2
3: 24
4: 175
Right 1161306718 19:3572957-3572979 GTCGCGCAGTCGGGAGGTCCGGG 0: 1
1: 0
2: 0
3: 3
4: 64
1161306710_1161306720 28 Left 1161306710 19:3572922-3572944 CCGACGGGGGCGGGCTGCGGGCG 0: 1
1: 0
2: 2
3: 24
4: 175
Right 1161306720 19:3572973-3572995 GTCCGGGAAAGTTTCTTTGGAGG 0: 1
1: 0
2: 0
3: 6
4: 76
1161306710_1161306717 11 Left 1161306710 19:3572922-3572944 CCGACGGGGGCGGGCTGCGGGCG 0: 1
1: 0
2: 2
3: 24
4: 175
Right 1161306717 19:3572956-3572978 CGTCGCGCAGTCGGGAGGTCCGG 0: 1
1: 0
2: 1
3: 1
4: 31
1161306710_1161306715 3 Left 1161306710 19:3572922-3572944 CCGACGGGGGCGGGCTGCGGGCG 0: 1
1: 0
2: 2
3: 24
4: 175
Right 1161306715 19:3572948-3572970 GGTTGGAGCGTCGCGCAGTCGGG 0: 1
1: 0
2: 0
3: 1
4: 19
1161306710_1161306714 2 Left 1161306710 19:3572922-3572944 CCGACGGGGGCGGGCTGCGGGCG 0: 1
1: 0
2: 2
3: 24
4: 175
Right 1161306714 19:3572947-3572969 TGGTTGGAGCGTCGCGCAGTCGG 0: 1
1: 0
2: 0
3: 2
4: 16

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1161306710 Original CRISPR CGCCCGCAGCCCGCCCCCGT CGG (reversed) Exonic
900109279 1:998806-998828 CGCCCCCAGCCCGCCCCCCCGGG + Intergenic
900119328 1:1041807-1041829 TGGCCGCAGCCCTCCCCCGGGGG - Intronic
900438726 1:2643121-2643143 AGCCCCCAGGCCGCCCCAGTGGG + Intronic
900769555 1:4529703-4529725 GGCCCTCTTCCCGCCCCCGTCGG + Intergenic
901086414 1:6614418-6614440 CGCCCCCAGCCCCTCCCCGCCGG + Intronic
901109903 1:6785801-6785823 CGGCCCCAGCCCGCCCCCGGGGG - Intronic
901511936 1:9721874-9721896 CGCCCCCTGCCCGCCCCCCAGGG - Intronic
901676578 1:10889023-10889045 CGCCCGCAGCCCGCCCGCCCCGG - Intergenic
901793040 1:11664432-11664454 CGCCCGCCGCCCGTCCCCCCGGG - Intronic
902373008 1:16017194-16017216 ATCCCACAGCCCGCCCCGGTGGG - Exonic
902401910 1:16162549-16162571 CGCCCGCATCCAGGCCCCGCGGG - Intergenic
902483424 1:16725034-16725056 AGCCCGCAGCTCGCGCCCCTCGG + Intergenic
903468371 1:23568134-23568156 CGCCCGCGCCCCGCGCCCGGCGG + Intergenic
905263617 1:36736117-36736139 TGCCCGCAGCCTGCCCACGTGGG + Intergenic
906130750 1:43453830-43453852 CGCCCGCCGCCCGCCGCCTTTGG - Exonic
907118698 1:51990516-51990538 CCCCGGCAGCCCGCCCGCGGAGG - Intronic
907429804 1:54405565-54405587 CGCCCCCTGCCCGCACCCGGTGG + Intronic
909657353 1:78046164-78046186 CTCCCGCCGCCCGCGCCCGTCGG - Exonic
916063518 1:161118282-161118304 CTCCCGCCGCCCGCTCCAGTTGG - Intronic
916107227 1:161441052-161441074 CACCCGCCCCCCGCCACCGTTGG + Intergenic
916108814 1:161448470-161448492 CACCCGCCCCCCGCCACCGTTGG + Intergenic
916110402 1:161455851-161455873 CACCCGCCCCCCGCCACCGTTGG + Intergenic
916111987 1:161463261-161463283 CACCCGCCCCCCGCCACCGTTGG + Intergenic
916113574 1:161470642-161470664 CACCCGCCCCCCGCCACCGTTGG + Intergenic
917904574 1:179575978-179576000 CGCCCTCAGCCCCCACCCGACGG - Intergenic
922775581 1:228213010-228213032 CGCCCCCAACCCGCCACCGCTGG + Intronic
923126593 1:231039661-231039683 CGCCCTCAGTCCGGCCCCGCTGG - Intronic
924853997 1:247857675-247857697 CGCCCGCAGCCCCCGCCGGGGGG - Intronic
1063963868 10:11329496-11329518 TGCCCGGCGCCCGCCCCCGGAGG + Intronic
1065483616 10:26216762-26216784 CGCCCGCAGCTCGCACTCGCAGG + Exonic
1065506851 10:26438223-26438245 CGCCTGCAGCCCGCCCTCAGGGG - Exonic
1067132099 10:43574326-43574348 TGGCCGCAGCCCGGCCCCGGGGG + Intronic
1067528205 10:47051064-47051086 CACCCGAAGCCAGCCCCAGTAGG + Intergenic
1067686131 10:48466830-48466852 CGCCCGAAGTCGGCCCCCGTGGG + Intronic
1067769813 10:49115311-49115333 CGCCCCCCGCCCGCGCCCGGAGG + Intronic
1069100822 10:64318429-64318451 CCCCTGCACCCCGCCCCTGTAGG + Intergenic
1070079171 10:73168409-73168431 CGCCCGCCGCCCGCCCCGGCTGG - Intronic
1070795328 10:79213047-79213069 CACCCCCACCCCGCCACCGTGGG + Intronic
1071511060 10:86262873-86262895 AGCCCTGAGCCCGCCCCCGCAGG + Intronic
1072151975 10:92690668-92690690 CGCCCCTGGCCGGCCCCCGTGGG + Intronic
1073099046 10:100997603-100997625 CCCACCCGGCCCGCCCCCGTCGG - Intronic
1073381173 10:103079067-103079089 GGCACGCAACCTGCCCCCGTGGG + Exonic
1073930122 10:108566365-108566387 CCCCTGCAGCCCGCCTCCCTGGG + Intergenic
1075031952 10:119029786-119029808 GGCCCGCAGCCCGCCCATGGAGG + Exonic
1075119209 10:119651864-119651886 GGCCCGCGGCCCGCCCTGGTCGG + Intronic
1075802098 10:125160247-125160269 CGCCCCCAGCCCGCGGCCGCAGG + Intronic
1077419563 11:2444228-2444250 CGCCCGCAGCTCGCGCGCCTGGG + Intergenic
1079237174 11:18699100-18699122 CGCCCCCAGCCCGCCCGCGGAGG + Intronic
1079251570 11:18791377-18791399 CGCCCCCGCCACGCCCCCGTGGG - Intronic
1083572508 11:63768224-63768246 CGCCCGCAGCGCCCCGCCTTGGG - Intronic
1083758281 11:64802817-64802839 CGCCCGCACCCCGCGCCCGCGGG + Intronic
1083759892 11:64810105-64810127 CGCCCACCGCCCGCCGCCATGGG - Exonic
1083886137 11:65574326-65574348 CGCCCCCAGCCCCGCCCCGGCGG - Intergenic
1084070086 11:66728226-66728248 CGCCTGCAGCCCGGCCGCGACGG + Intronic
1087117997 11:94544530-94544552 CGCCCGCCCGCCGCCGCCGTCGG - Exonic
1089306381 11:117528924-117528946 CGCCCCCCGCCCCCCCCCTTGGG + Intronic
1089496447 11:118910615-118910637 CACCCCCACCCCGCCCCCTTCGG + Exonic
1089732451 11:120527579-120527601 AGCCCCCAGCCCGCCCCTGGAGG - Intronic
1091259513 11:134223757-134223779 CGCCCCCACCCCGCCCCCACCGG + Intronic
1093736409 12:22625309-22625331 CGCCCCCAGCCCTCCCGCGAGGG + Exonic
1094846234 12:34362596-34362618 CGCCTTCAGCTGGCCCCCGTGGG + Intergenic
1094850048 12:34378314-34378336 CGCCTTCAGCTGGCCCCCGTGGG + Intergenic
1096105477 12:48994962-48994984 TGCCCCCAGCCCACCCCTGTCGG - Intergenic
1096670883 12:53197662-53197684 CGCCCGCCGCCCACCCCCTAGGG - Exonic
1097237492 12:57550074-57550096 CGCCCGCATCCCGCTGCCGCAGG + Exonic
1098450097 12:70609994-70610016 CGTCCGCAGCCCGCCCGGGGCGG - Intronic
1102028032 12:109724524-109724546 CGCCAGCAGCCCACCCTCCTCGG + Intronic
1103488234 12:121296876-121296898 CGCCCCCTGCGCGCCCCCGCCGG + Intronic
1103698539 12:122835639-122835661 CGCCCGCCGCCCGCTCGCCTGGG - Exonic
1105059026 12:133130551-133130573 CGCACGCGCCCCGCCCCCATTGG - Intergenic
1110573134 13:77027209-77027231 CGCCCCCTTCCCGCCCCCTTGGG - Intergenic
1114270799 14:21098623-21098645 CGCCCGCACCCCGCCCCTGGCGG - Exonic
1117478121 14:56118171-56118193 CGCCCACTCCCCGCCCCCCTCGG - Intronic
1118601536 14:67473928-67473950 CCCCCGCAGCCAGCCCCAGTCGG - Exonic
1121137334 14:91510407-91510429 CGCCCGCCTCCCGCCTCCGTCGG - Intronic
1122131026 14:99604523-99604545 CGCCCGCGGCCGGCTCCCGGCGG + Intergenic
1122408317 14:101513315-101513337 CTCCCGCTACCCGCCCCCGTGGG + Intergenic
1122582073 14:102777375-102777397 CCCCCGCCGCCCGCGCGCGTGGG - Intergenic
1122940287 14:104978147-104978169 CGCCTGCAGCCCGCTCCCCTGGG - Intronic
1124202857 15:27693217-27693239 TGCCCGCAGCCCTCCCCAGGCGG - Intergenic
1127674662 15:61228391-61228413 CGCCCGCACCCCGCTTCCTTCGG + Intronic
1128374424 15:67065427-67065449 CGCGCCCAGCACGCCCACGTGGG - Intronic
1129108335 15:73323545-73323567 CGCCAGCAGCCCGTCCCAGGTGG - Exonic
1129387000 15:75201853-75201875 CGCCCCCAGCCCGCCCCGCCCGG + Intronic
1130224600 15:82047151-82047173 CGCCCGCGGCCCCGCCCCGACGG + Intergenic
1132684096 16:1155008-1155030 TGCCCGCAGACGTCCCCCGTCGG + Intronic
1132815938 16:1826651-1826673 CGCCCGCTGCCCGCCCCGCCAGG + Intronic
1133784397 16:8963512-8963534 CGCCGGCCGCCCGCCCGCCTCGG - Intronic
1134539933 16:15056035-15056057 CGCCCGCCGCCCCCGCCCCTCGG + Exonic
1136414783 16:30096358-30096380 CCCCCGCCGCCCGCTCCCGCCGG + Intronic
1139580860 16:67872969-67872991 CTCCCGCAGCCAGTCCCCCTCGG - Intergenic
1141480791 16:84305315-84305337 CGCCTCCAGCCCTCCCCAGTAGG - Intronic
1141828903 16:86498647-86498669 CACCCGGGGCCCGCCCCCTTGGG - Intergenic
1141910113 16:87053124-87053146 CGCCCCCAGCCCTCCCCAGCTGG + Intergenic
1143202362 17:5121770-5121792 GGCCCCCAGCCCGCCCCAGCAGG - Intronic
1143598521 17:7929589-7929611 CTCCAGCAGCCCGCCCCCGCGGG - Intronic
1144627011 17:16849159-16849181 GGCCCCCAGCCCGCCCCAGCAGG + Intergenic
1144879429 17:18423553-18423575 GGCCCCCAGCCCGCCCCAGCAGG - Intergenic
1145152812 17:20520834-20520856 GGCCCCCAGCCCGCCCCAGCAGG + Intergenic
1147264281 17:39225549-39225571 CACCCGCAGCCTGCCCGCGGTGG - Exonic
1147384687 17:40074297-40074319 CTCCCACCGCCCGCCCCCCTTGG + Exonic
1147986091 17:44308564-44308586 CTCCAGCCGCCCGCCCCCCTCGG - Exonic
1148108578 17:45132261-45132283 CGCCCGCAGCCCGGGCCTCTTGG + Exonic
1152581427 17:81166962-81166984 TCCCCCCAGCCTGCCCCCGTGGG + Intergenic
1152744332 17:82032018-82032040 CGCCCGCAGCCAGCCCAAGCGGG - Intronic
1153285138 18:3449923-3449945 CGCCCGCATCCCTCGCCCGGCGG - Intronic
1156448656 18:37254237-37254259 CGCCCGCCCCCCACCCCCGCCGG + Intronic
1158846132 18:61444615-61444637 CTCCGGCAGCCCTCCCCCTTTGG - Intronic
1160062379 18:75544188-75544210 CACACGCAGCCCGCCCCTGGGGG - Intergenic
1160858479 19:1227752-1227774 CGGGCGCAGCCCTCCCCCCTCGG + Exonic
1160983652 19:1827781-1827803 CTCCCGCAGGCCGCCCCCCTCGG + Exonic
1161080286 19:2307151-2307173 CGCCCGCTCCCCACCCCCGCCGG + Intronic
1161108783 19:2456977-2456999 CGCCCGCCGCCCGCCGCGGCGGG + Exonic
1161306710 19:3572922-3572944 CGCCCGCAGCCCGCCCCCGTCGG - Exonic
1161925043 19:7293865-7293887 CGCCCCCCGCCGGCCCCCGGTGG + Exonic
1162524110 19:11197579-11197601 CGCCCGCACCACGCCCCCTCCGG + Intronic
1163103459 19:15110418-15110440 CGCCCGGAGCCCAGCCCCCTAGG - Intronic
1163158214 19:15450081-15450103 CGCCCGCTGGCCGCCCCCCCCGG - Intergenic
1163613484 19:18312565-18312587 CCCCTGCATCCCACCCCCGTTGG + Intronic
1165065380 19:33225520-33225542 CGCCCGGCGCCCGCCCGCCTGGG + Intronic
1166745979 19:45142084-45142106 CGCCCGCAACACGCCCCTGCTGG + Exonic
1166748235 19:45152060-45152082 CGCCTCCAGGGCGCCCCCGTCGG - Exonic
1167594155 19:50418571-50418593 GGCCCCCAGCCCGCCCCTGCTGG + Intronic
926217062 2:10912247-10912269 CCCCCGCGGCGCGCCCCCGCAGG + Exonic
927572994 2:24175777-24175799 GCCCGGCTGCCCGCCCCCGTCGG - Exonic
927714275 2:25342091-25342113 CGCCCGCCGCTCGCCCCCCGCGG + Intronic
932342997 2:70978576-70978598 CGCCGGCGCCCCGCCCCCGGGGG - Intronic
936104613 2:109613991-109614013 CGCCCCAACCCCGCCCCCGGAGG - Exonic
936713658 2:115161565-115161587 CCCCCACCGCCCGCCCCCGGGGG - Intronic
937917742 2:127107195-127107217 CGCCCCCCGCCCGCCCCCTCCGG + Exonic
947829760 2:233130660-233130682 CCCCACCTGCCCGCCCCCGTGGG - Intronic
948456508 2:238106967-238106989 CGCCAGCAGCCCGTCGCCTTCGG - Intronic
1172422000 20:34825601-34825623 CGCCCGCAGCCCGACCCGGCAGG + Intronic
1175847391 20:62065876-62065898 CGCCCAGCGCCCGCCCCAGTCGG - Intergenic
1176145075 20:63561893-63561915 AGCCCGGAGGCCCCCCCCGTGGG - Exonic
1178327776 21:31659586-31659608 CGCGCTCAGCCCGCCCCCTGCGG - Intergenic
1180014692 21:45074537-45074559 CGCCCCCTCCCCGCCCCCGCCGG - Intronic
1180091326 21:45535097-45535119 CGTCCCCAGCCAGCCCCTGTTGG - Intronic
1180876895 22:19178830-19178852 CGCCCCCAGCCCGCCCCGTGCGG + Exonic
1181450515 22:23017140-23017162 CCCCCGCTCCCCGCCGCCGTGGG - Intergenic
1183407857 22:37639376-37639398 CGCCCGCAACCCGCCCCAGGCGG - Intronic
1183650913 22:39152771-39152793 CCCCCGGGGCCCGCCCCCGCGGG + Intergenic
1184101565 22:42343922-42343944 CGCCCGCGCCCCTCCCCCGCCGG - Intergenic
1184651795 22:45922679-45922701 CGCCCTCTGCCCGCCTCCCTGGG - Exonic
1203255539 22_KI270733v1_random:135687-135709 CGCCCGCCGCCCGCCACCCGCGG - Intergenic
950193301 3:10992649-10992671 CGCCCGGAGCCCGCCCAGCTCGG - Intergenic
950207491 3:11092063-11092085 CTCCCGGAGCCCGCCACCCTGGG + Intergenic
950912152 3:16605519-16605541 CCCCCGCAGCCCCCCCACGCAGG - Intronic
953618220 3:44510722-44510744 CGCCCGCCGCCCGCCGCCAGCGG - Intergenic
965793326 3:172411790-172411812 CTCCCGCAGCCCGCCACCCTAGG - Intergenic
968972280 4:3802297-3802319 TGCCCGCGGCCCGCCCCTGCAGG - Intergenic
969344557 4:6563020-6563042 CTCCCGCTGCCCGCGCCGGTGGG - Intronic
969619161 4:8270261-8270283 CGCCTGCAGCGCGCACACGTTGG - Exonic
972162586 4:36244519-36244541 CGCCTGCTCCCCGCCCCCGCGGG - Intergenic
984908288 4:184649492-184649514 CGCCTCCCGCCCGCCCCTGTCGG + Intronic
984952648 4:185018652-185018674 TGCCCCCAGCTCGCCCCCCTCGG + Intergenic
985064061 4:186104740-186104762 CGCCCGCCGCCCGCCGCCCGCGG - Intronic
989261661 5:39425200-39425222 CACCCGCCCCCCGCCCGCGTCGG - Intronic
990895931 5:60700166-60700188 CGCCCGCAGCCCGCGGGCTTGGG - Intronic
997521780 5:134527712-134527734 CGCCTCCAGCCCGCCCCTGGAGG - Intronic
1002430024 5:179198135-179198157 GGCCCGCCCCCCGCCCCCGAGGG - Intronic
1003064520 6:2891914-2891936 CGCGCGCACCTCGCCCACGTGGG + Exonic
1007361366 6:41358704-41358726 CACCCCCCGCCCGCCCCCATAGG + Intergenic
1007701776 6:43770117-43770139 CGCCCCCGGCCCGCCCCGGGGGG - Intergenic
1007783202 6:44265634-44265656 CGCCCCCTCCCCGCCCCCGGCGG + Exonic
1013048757 6:106512107-106512129 CGCCCGCAGCCAGCCCCCCAAGG + Exonic
1019676313 7:2314538-2314560 CGCCCACAGTCCGCCCCTGCGGG + Intronic
1021992505 7:26152133-26152155 CGCCCGGGGCCCGCGCCCGTGGG - Intergenic
1022066533 7:26864479-26864501 CAGCCGCAGCCCCACCCCGTCGG - Exonic
1023221247 7:37921395-37921417 CGCCAGCAGGCCGCCCTCGGTGG - Intronic
1024043813 7:45574446-45574468 CGCCCGCCGCCCGCCCGCCCCGG + Intronic
1029407129 7:100382006-100382028 CACCCCCACCCCACCCCCGTAGG + Intronic
1029540617 7:101180086-101180108 CGCCCGCCGCCCGCCCCGCTTGG - Exonic
1029640305 7:101816122-101816144 CGCCCGCAGCCCCCACCCCCGGG - Intronic
1033596719 7:142864351-142864373 AGCCCGCTGCCCAGCCCCGTGGG - Exonic
1034967065 7:155398231-155398253 CCCCCGCCCCCCGCCTCCGTGGG - Intergenic
1035770850 8:2145624-2145646 GGCCAGCAGCCCAGCCCCGTGGG - Intronic
1036752364 8:11451307-11451329 GGCCCGCAGCTGGGCCCCGTGGG + Intronic
1040014509 8:42689786-42689808 CCCCCCCACCCCGCCTCCGTGGG + Intergenic
1047100166 8:121667535-121667557 CGCCCCCGCCCCGCCCCCGCCGG - Intergenic
1049760683 8:144330792-144330814 CGGCCGCAGCCCCCACCCGAGGG + Exonic
1053319201 9:37080205-37080227 GACCCGCAGCCCGGCCGCGTGGG - Intergenic
1053323520 9:37120797-37120819 GACCCGCAGCCCGGCCGCGTGGG - Exonic
1053493170 9:38526874-38526896 CGGCCGCCGCCCGCCCCCGTGGG + Intergenic
1057636934 9:96777859-96777881 CCCCCGGAGCCCGCCCCCACCGG + Exonic
1057669652 9:97076865-97076887 GGCCCTCAGCCCTGCCCCGTGGG - Intergenic
1060139889 9:121201249-121201271 CGGCCGCAGCCCGCCCCCGCAGG - Intronic
1061073003 9:128323155-128323177 CGCCCGCGCCTCGCCCCCGTGGG + Intronic
1061450464 9:130664592-130664614 CGCCCGCCCACCTCCCCCGTCGG + Exonic
1062495574 9:136830021-136830043 CGTCCGCAGCACCCCCCCGCTGG - Intronic
1062548993 9:137077427-137077449 CGCCCGGGGCCCGCCCCACTGGG + Intergenic
1062596418 9:137301933-137301955 GGCCCGCGGCCCGCGCCCGGCGG - Exonic
1203794678 EBV:169998-170020 TGCCCGCTCCCCGCCCCCCTTGG - Intergenic
1203794879 EBV:170536-170558 TGCCCGCTCCCCGCCCCCCTTGG - Intergenic
1203795070 EBV:171059-171081 TGCCCGCTCCCCGCCCCCCTTGG - Intergenic
1203795271 EBV:171597-171619 TGCCCGCTCCCCGCCCCCCTTGG - Intergenic
1190862538 X:54358186-54358208 CGCACGCCTCCCGCCCCCCTCGG + Intronic
1191934669 X:66413788-66413810 CGCCCCCACCCCGCCCATGTGGG + Intergenic
1195217077 X:102712833-102712855 CGCCCGCGCCCCGCCCTCGACGG + Intronic
1195654715 X:107323805-107323827 CCCCCGCAGCCTGCCGCCCTGGG + Intergenic
1197331148 X:125155556-125155578 CTCCCCCCGCCCGCCTCCGTGGG - Intergenic
1198750296 X:139932171-139932193 CGCTCGCCGCCTGCCCCCCTCGG + Intronic