ID: 1161307061

View in Genome Browser
Species Human (GRCh38)
Location 19:3574056-3574078
Sequence GGCCCACAGGACCAAGGGGA GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 331
Summary {0: 1, 1: 0, 2: 2, 3: 35, 4: 293}

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1161307061_1161307070 14 Left 1161307061 19:3574056-3574078 CCCTCCCCTTGGTCCTGTGGGCC 0: 1
1: 0
2: 2
3: 35
4: 293
Right 1161307070 19:3574093-3574115 AAACCACGCCCACCAAGCAGAGG 0: 1
1: 0
2: 0
3: 9
4: 113

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1161307061 Original CRISPR GGCCCACAGGACCAAGGGGA GGG (reversed) Intronic
900523441 1:3117045-3117067 TGCCCCCAGGACCCACGGGAAGG + Intronic
900654140 1:3746883-3746905 GTCCCACAGGAGAAGGGGGAGGG + Intergenic
900826035 1:4927784-4927806 GGCCACCAGGACCAAATGGATGG - Intergenic
901140672 1:7027384-7027406 GGCCCACGAGACCTGGGGGAAGG + Intronic
901217962 1:7565290-7565312 GGCCCACGGGCCTATGGGGATGG + Intronic
901251759 1:7784458-7784480 GGCCCCCAGTACCGAGGGCAGGG - Intronic
901626885 1:10629733-10629755 GGCCCCCAGGAGGAAGGCGAGGG + Exonic
903773241 1:25777323-25777345 AGCCCTGGGGACCAAGGGGAGGG - Intronic
903796713 1:25934557-25934579 GGTCCACAGGCCCAAGGGGAGGG - Intergenic
905973457 1:42157690-42157712 GGCCCACAGGACGCAGGGCCAGG - Intergenic
906700142 1:47851798-47851820 TGCTCACAGAACCAATGGGAAGG - Intronic
907282418 1:53359819-53359841 GGCCCAGAGGACAAAGGCCAAGG + Intergenic
907408323 1:54267669-54267691 GGACCACCAGGCCAAGGGGAAGG + Intronic
907475465 1:54702276-54702298 CGCCCACAGGACCCGAGGGAGGG - Intronic
907674605 1:56506895-56506917 GGTACACAGGACAAAGGAGAAGG - Intronic
909037370 1:70609302-70609324 AGCCCACAAAACCAAAGGGAGGG - Intergenic
913225384 1:116694258-116694280 GGCGTACAGGAGCATGGGGAAGG - Intronic
914509307 1:148317494-148317516 GGCCCTCAGGACAAAAGGGATGG - Intergenic
918394177 1:184096985-184097007 AGCCCACAGGTCCATGTGGAGGG - Intergenic
919580227 1:199363132-199363154 GGAGGACAGCACCAAGGGGATGG - Intergenic
919803853 1:201369273-201369295 GGAGCACAGGACCAAGGCAAGGG - Intronic
920286782 1:204885372-204885394 CCCCCACAGGGCAAAGGGGAGGG - Intronic
922494517 1:226046099-226046121 GGTACACAGGGTCAAGGGGAAGG - Intergenic
923358178 1:233181532-233181554 GGGCAACTGGATCAAGGGGAAGG - Intronic
924056191 1:240126886-240126908 GGAACACAGGACCAACAGGATGG + Intronic
924452311 1:244189479-244189501 TGACCACAGCACCAAGGGGATGG - Intergenic
924936677 1:248777726-248777748 GGCCCACTGAAGCAAGGGGTGGG - Intergenic
1064156107 10:12904535-12904557 GGACCACAGGCCAATGGGGAGGG + Intronic
1065252428 10:23829343-23829365 GGCCCACAGAACCTAGAGGAAGG + Intronic
1066488583 10:35872548-35872570 GGGCCAGAGGACGCAGGGGAAGG + Intergenic
1069217695 10:65842584-65842606 TGAAAACAGGACCAAGGGGATGG + Intergenic
1069291512 10:66786104-66786126 GGCCTGTAGGATCAAGGGGAGGG - Intronic
1070407220 10:76107639-76107661 GGGCTAAAGGACCAAGGGGGAGG - Intronic
1072012908 10:91319645-91319667 GGCCCACACATACAAGGGGAAGG + Intergenic
1072488171 10:95875887-95875909 TTCCCACAGGACCCAGGGGGAGG - Exonic
1072608188 10:97000717-97000739 GGGCCACAGGCCAAAGGGAAGGG + Exonic
1072759640 10:98045850-98045872 GGCCCAGAGGACTAGGGTGAGGG - Intergenic
1072769820 10:98128333-98128355 AGCCCACATATCCAAGGGGAAGG + Intergenic
1072948694 10:99834008-99834030 AGCATAGAGGACCAAGGGGAAGG - Intronic
1073155382 10:101342204-101342226 GGCCCCAAGGGCCAAGGGAAGGG - Intergenic
1074137137 10:110637567-110637589 GGCCCAGAGCAGCAAGGGGGAGG - Intergenic
1074345930 10:112686471-112686493 GGCAGACAGGCCCAAGGGTAGGG - Intronic
1076424562 10:130358440-130358462 GGCCCAGAGGGCCAAGAGCAGGG - Intergenic
1076473324 10:130735374-130735396 GGCCCACAGGCACCAGGGGAGGG + Intergenic
1076692548 10:132231100-132231122 GGGTCACAGGGCCAAGGGGCTGG - Intronic
1076763756 10:132619358-132619380 GGCACACAGGCTCAAGGGGTGGG + Intronic
1076855507 10:133113838-133113860 GGTCCACAGGGACATGGGGAAGG - Intronic
1077233978 11:1471059-1471081 GGCCCAGAGGGCCAGGGAGATGG + Intronic
1077347845 11:2072519-2072541 GGACCACAGGAGCAAGGGTCGGG + Intergenic
1077395400 11:2318044-2318066 GGACCACAGGACCAGGGACAAGG - Exonic
1077480184 11:2810947-2810969 GGCCCACAGCACCAAGACGATGG - Intronic
1077895674 11:6451441-6451463 GGAGCAGAGGAGCAAGGGGAGGG + Intronic
1078095111 11:8291938-8291960 AGCCCACAGGGTCAAGAGGAGGG + Intergenic
1079151500 11:17903947-17903969 GGCCTACACGGCCAAGGTGAAGG - Intronic
1080412661 11:32040477-32040499 GCCCCTCAGGTGCAAGGGGAAGG + Intronic
1080418880 11:32092822-32092844 GGCCCCCAGGAGCACAGGGATGG - Intronic
1080959650 11:37143859-37143881 CGCCCAAAAAACCAAGGGGAAGG - Intergenic
1083299694 11:61733929-61733951 GGCCCAGAGGAGCAAGGGCCAGG + Intronic
1083883077 11:65557963-65557985 GGGCCGCAGGACCCGGGGGAGGG + Exonic
1085053318 11:73390746-73390768 CTCCCACAGGACCCAGGGCAGGG + Exonic
1085408227 11:76276785-76276807 GGCACACAGGACCAACTGGGGGG - Intergenic
1085454120 11:76656189-76656211 GGGCTGCAGGGCCAAGGGGAGGG + Intergenic
1086047712 11:82552331-82552353 GGCTCACAGGACCATTTGGAAGG + Intergenic
1088917295 11:114237380-114237402 GGTCCACATGACACAGGGGAAGG - Intronic
1089403769 11:118180862-118180884 GCCCCCCAGGACCAAGGGTCAGG + Intergenic
1089546834 11:119233845-119233867 GGCCAACAGGCCCAAAGGAAAGG - Intronic
1090350327 11:126103920-126103942 AGTCCACAGGAACAAGGGAAGGG - Intergenic
1090923832 11:131232411-131232433 GGCCCAGAGGAACAAAAGGAAGG - Intergenic
1091327473 11:134701800-134701822 GGCCGCCAGGACCCAGGGGAAGG - Intergenic
1091956157 12:4645272-4645294 GGTCAACAGGACAAAGAGGAGGG + Intronic
1094845431 12:34359413-34359435 GGCCCACAGGACTCAGCGCAAGG - Intergenic
1095367995 12:41431011-41431033 GGAGAACAGTACCAAGGGGATGG + Intronic
1096193033 12:49632529-49632551 GGCCCCCAGGACCCAGGCCATGG - Intronic
1096260588 12:50087723-50087745 GGCCAGCAGCACCAAGAGGAAGG - Intronic
1097248239 12:57618328-57618350 GGACCAGAGGATCATGGGGAGGG + Intronic
1103305738 12:119962592-119962614 GGCCCACTGGACCCATGGAAGGG - Intergenic
1103322124 12:120098326-120098348 TGCCCACAGGCCCAGGTGGATGG + Intronic
1103508346 12:121456215-121456237 GGCCCACAGACCCACTGGGATGG + Intronic
1103852066 12:123939891-123939913 GTCCCACAGGCCCTGGGGGAAGG - Intronic
1105730644 13:23211979-23212001 GGACAACAGCACCAAGGGGATGG - Intronic
1105780655 13:23702702-23702724 GGGCCACAGGAACAAGGGGATGG + Intergenic
1108090421 13:46843641-46843663 AGCCCAGAGCACCATGGGGAAGG + Intronic
1108623520 13:52206170-52206192 TTCCCACAGCCCCAAGGGGATGG + Intergenic
1113295973 13:108959058-108959080 GGTCCACAGGAGGAAGGGGAAGG + Intronic
1114528384 14:23380143-23380165 GGCCCACAGGACGCAGGGAGAGG + Intergenic
1118579189 14:67276344-67276366 GGCTCACATGACCAATAGGAAGG - Intronic
1119613626 14:76083963-76083985 GGCCCAGAGCACCCACGGGAAGG - Intronic
1121724637 14:96138254-96138276 GGCCCACAGACCCAAGTGGGTGG + Intergenic
1121748051 14:96318285-96318307 ACCCCACAGGACTGAGGGGAGGG - Intronic
1122410468 14:101523111-101523133 GGCCCACAGGAATGTGGGGATGG + Intergenic
1122686497 14:103510492-103510514 GGCCCAGAGGACGGAAGGGATGG + Intergenic
1122783174 14:104152290-104152312 GCCAGACAGGACCAAGGGGCTGG + Exonic
1123152201 14:106193311-106193333 GGCACACTGGAACAAGGGGTGGG + Intergenic
1125589941 15:40847711-40847733 AGCCCCCAGGACCAAGGAGCAGG - Intronic
1125600791 15:40914900-40914922 GGCCCACATGTCCAAGGATAGGG - Intergenic
1128777181 15:70329419-70329441 AGCCCTCATGTCCAAGGGGAGGG - Intergenic
1129324622 15:74793560-74793582 GGCCCACAGGGGCAAGGCGGGGG - Intronic
1130407054 15:83611650-83611672 GGACCACAGGGGCAAGGGGAAGG + Intronic
1131090974 15:89624832-89624854 GGCCCACAGGAAGGAGGAGATGG - Exonic
1131599232 15:93829846-93829868 GGGCTACAGGTCCAAGGGGAAGG + Intergenic
1132494239 16:253223-253245 GGCCAGCAGGAACCAGGGGAAGG + Intronic
1132575702 16:662829-662851 TGGCCACAGGAGCAAGGTGAGGG + Exonic
1132751662 16:1460472-1460494 GGCCCACAGCAACAGGGAGAAGG + Exonic
1135585463 16:23667434-23667456 CATCCACAGGACCAAGGGGCTGG - Exonic
1136172668 16:28498045-28498067 GGCACAGAGGACCATGGGGCCGG - Intronic
1136459184 16:30399128-30399150 GGCCCAGGAGACCAAAGGGAGGG + Exonic
1136619494 16:31418580-31418602 AGGCCAGAGGTCCAAGGGGAAGG - Intronic
1137421829 16:48341499-48341521 GGACGACAGTACCAAGGGGATGG + Intronic
1138105116 16:54283968-54283990 GGCCCACAGGCCCCTGGGGCGGG - Intronic
1138290961 16:55846532-55846554 GGCAGACAGGATCAGGGGGATGG + Exonic
1140501353 16:75436111-75436133 GCCCCACAGAAACCAGGGGAGGG - Intronic
1140665205 16:77221141-77221163 CGACCACAGCATCAAGGGGAAGG + Intergenic
1141177900 16:81732813-81732835 GGCCCACAGGGGGAAGGGGCTGG - Intergenic
1141606105 16:85154260-85154282 GCCCCAGCAGACCAAGGGGAAGG + Intergenic
1142797702 17:2321718-2321740 GTCCCAAAGGAATAAGGGGAAGG - Intronic
1143539359 17:7560102-7560124 GGCCTACAGGCCCAAGGATATGG + Exonic
1144172509 17:12672004-12672026 GGCCCACAGGACAGAAGGAATGG - Intronic
1146371391 17:32266983-32267005 GGCCCGCAGGACCGGAGGGATGG - Intronic
1146894184 17:36529347-36529369 GGACCACAGGAGGAAGTGGAGGG - Intronic
1147760594 17:42795319-42795341 GGCCACCAGGAGCAACGGGAGGG - Exonic
1148134531 17:45283810-45283832 TGCCCAGAGGGCCAAGGGGATGG + Intronic
1148646067 17:49220190-49220212 GGCCCCCACGCCCAAGGGGCAGG + Exonic
1148796887 17:50201344-50201366 GGCCCCCGGGACCAAGCGCAAGG + Intronic
1148846366 17:50532457-50532479 GGCCCAGAGGAGGAAGGGGAGGG + Intergenic
1149310023 17:55384593-55384615 GGCCCACAGGCACAAGTGCAAGG - Intergenic
1151316068 17:73323481-73323503 TCCCCCCAGGAACAAGGGGAAGG + Intergenic
1151421836 17:74003618-74003640 GGACAACAGTACCTAGGGGAAGG + Intergenic
1151875238 17:76864258-76864280 GGCCAGCAGGACCCAGGGGCAGG + Intergenic
1151924671 17:77186262-77186284 GACCCACAGCCCCCAGGGGAGGG - Intronic
1152923377 17:83076924-83076946 CTCCCAGAGGACCAGGGGGAGGG + Intergenic
1153770999 18:8416389-8416411 GGACCACAGGACACTGGGGAAGG + Intergenic
1155058792 18:22210196-22210218 AGCCCACAGCACCAAGGTCATGG - Intergenic
1156468330 18:37362019-37362041 GGACCCCAGGACCCAGGTGAAGG - Intronic
1160569169 18:79804702-79804724 AGCCCACGGGAACAAGTGGAGGG + Intergenic
1160586162 18:79914747-79914769 GGCCCACAGGCCCAAAGAGACGG + Intronic
1160717920 19:584804-584826 TGCCAACAGGACGATGGGGAAGG + Intergenic
1160935233 19:1591629-1591651 GGGACACTGAACCAAGGGGAGGG + Intronic
1161076719 19:2289515-2289537 GCCCCACAGCCCCAAGGGGAGGG - Intronic
1161143699 19:2664497-2664519 GGCACACAGAACAAAGGGGCAGG + Intronic
1161307061 19:3574056-3574078 GGCCCACAGGACCAAGGGGAGGG - Intronic
1161354169 19:3810072-3810094 GGCACACAGGCCCAGTGGGAGGG + Intronic
1161550156 19:4908467-4908489 GGCCCACTGAGCAAAGGGGAGGG - Intronic
1162068502 19:8139932-8139954 GGCCCCCAGGTGCAAGGGGAGGG - Intronic
1163120667 19:15215570-15215592 GGCCCAGAGGAGGAAGGAGAGGG + Intergenic
1163587731 19:18173204-18173226 GTCCCACGGGACCACGGTGAGGG + Intronic
1163608792 19:18290631-18290653 GGCCCACAGGACCGTGGGTGGGG - Intergenic
1163722502 19:18904931-18904953 GGCCCACCGGAGCCTGGGGATGG + Intronic
1165025354 19:32957017-32957039 GTCCCACAGCTCAAAGGGGAAGG - Intronic
1165161703 19:33820426-33820448 TCCCCGCAGGGCCAAGGGGAGGG + Intergenic
1166878720 19:45914088-45914110 GGCTGACAGGTCCAAGGGGGCGG + Exonic
1167524041 19:49972703-49972725 TGCCCCAGGGACCAAGGGGAGGG + Intergenic
1168251663 19:55145661-55145683 GGCCCCCAGGACCCCAGGGAAGG + Intronic
925071552 2:972668-972690 GGAGGACAGTACCAAGGGGATGG - Intronic
925838297 2:7966609-7966631 GGTCCACAGGACCAGGGAGATGG + Intergenic
925838315 2:7966684-7966706 GGTCCACAGGACCAGGGAGATGG + Intergenic
925845944 2:8033681-8033703 GGCCCACAGGGCCGTGTGGAGGG - Intergenic
926247084 2:11129814-11129836 GGCTTACGGGACAAAGGGGACGG + Intergenic
926303243 2:11618729-11618751 GGCCCACATGACCGAGGGGGAGG - Exonic
927713216 2:25338509-25338531 GGCGCACAGCAGCAGGGGGAAGG + Intronic
928134583 2:28678660-28678682 GGCCCACAGCACCAAGGACACGG + Intergenic
928696367 2:33853655-33853677 GGCCCAGAGGCCTAAGAGGATGG - Intergenic
928945374 2:36767263-36767285 GGGCCACAGGAGCCAGGAGATGG + Exonic
929489874 2:42386564-42386586 GGCCCACAGCAAGAATGGGAGGG - Intronic
931633682 2:64323298-64323320 GCCACTCAGGACCCAGGGGAAGG - Intergenic
932114505 2:69034259-69034281 GGCTCACTAGACCATGGGGAGGG - Intronic
932559053 2:72851272-72851294 CGTCCACGGGGCCAAGGGGATGG - Intergenic
934518130 2:95001563-95001585 GGCCTGCAGTACCAAGAGGAAGG + Intergenic
934705039 2:96471092-96471114 GCCCCACAGGAACAAGCGGAGGG - Intergenic
935245993 2:101219259-101219281 GGCCCAGAGAAACAAAGGGAGGG - Intronic
936385025 2:112021607-112021629 GTCCCACAGCACAAAGAGGAGGG + Intronic
936567655 2:113593461-113593483 GGTCCACAGGGGCAATGGGAGGG - Intergenic
938489397 2:131754004-131754026 GGTCCACAGGGCCAAGCGCAGGG - Intronic
938595691 2:132785099-132785121 GGCCCACAGGGCCAAGGCCATGG - Exonic
938974092 2:136458958-136458980 GGCACACTGGTCCAAGGGGTGGG + Intergenic
939392818 2:141590881-141590903 GGCACACAGGAACAACGGAAAGG - Intronic
940635397 2:156292705-156292727 GGCCCAAAGGATCAAGGTGAGGG + Intergenic
941416724 2:165230509-165230531 GGTCCAGAGGACCCAGTGGAGGG - Intergenic
943424071 2:187707365-187707387 GACCAACAGTACCAAGGGGATGG - Intergenic
948234658 2:236379272-236379294 GAGTGACAGGACCAAGGGGAGGG + Intronic
948234672 2:236379310-236379332 GAGCGACAGGACCAAGGGGAGGG + Intronic
949000407 2:241610066-241610088 GGCCCTCGGGACCCAGGGGCCGG - Intronic
1169458538 20:5774688-5774710 GGAACTCAGCACCAAGGGGATGG + Intronic
1170122088 20:12922742-12922764 GGCACACTGGTGCAAGGGGAGGG - Intergenic
1170153984 20:13253021-13253043 GCCACACAGGTCCATGGGGAAGG - Intronic
1170683486 20:18547639-18547661 AGGCCACAGGGCCAGGGGGAAGG - Intronic
1171497943 20:25570348-25570370 TGACAACAGCACCAAGGGGATGG - Intronic
1172780011 20:37431019-37431041 GGCCGTCAGCACCAAGGGCAGGG - Intergenic
1173020476 20:39263692-39263714 GGAGAACAGCACCAAGGGGATGG + Intergenic
1175519111 20:59588402-59588424 GGCCCCAGGGACCAGGGGGACGG - Intronic
1177835682 21:26184224-26184246 GGCACACTGGAGCAAGGGGTGGG + Intergenic
1178218202 21:30625106-30625128 GGCACACTGGTCCAAGGGGTGGG + Intergenic
1178320975 21:31605434-31605456 GGAGAACAGCACCAAGGGGATGG - Intergenic
1178520419 21:33284671-33284693 GGAGGACAGCACCAAGGGGATGG - Intronic
1178600952 21:33993755-33993777 GCAACACAAGACCAAGGGGAGGG - Intergenic
1179564157 21:42235902-42235924 GGCCCCCTGAACCATGGGGATGG - Intronic
1181672941 22:24434205-24434227 GGCCCAGAGGATCTGGGGGAAGG - Intronic
1181769017 22:25112213-25112235 GACCCACATGACCCAGTGGATGG + Intronic
1183102846 22:35594388-35594410 GGCCCACAGGCCTCATGGGAAGG - Intergenic
1183539970 22:38424097-38424119 GGCCCAGAGAACCAGGGGGCTGG - Intergenic
1184341686 22:43889663-43889685 GCCCCCCAGGAGCAGGGGGAGGG + Intronic
1184477802 22:44730800-44730822 GGCCCAGAGGACCCAGGGCCAGG - Intronic
1184842252 22:47058863-47058885 GGCCCGCTGGACCCAGGTGAAGG + Intronic
1185207978 22:49551127-49551149 GGCCCCCAGTCCCAAGGGGTAGG + Intronic
1185292497 22:50034241-50034263 GGCCCACAGCACCACAGGGAAGG - Intronic
949107374 3:217073-217095 TGCACACAGGACCAAAGGGTGGG - Intronic
950498222 3:13347117-13347139 GCCTCACAGGACCCAGGAGATGG + Intronic
952807825 3:37374393-37374415 TGACAACAGCACCAAGGGGATGG + Intergenic
953202979 3:40794435-40794457 TCCCCACAGGAGCAAGGAGAGGG + Intergenic
953435462 3:42874193-42874215 GTGCCACAGGACCAGAGGGAGGG + Exonic
954036969 3:47856086-47856108 TGCCCATGAGACCAAGGGGAAGG + Intronic
954214883 3:49119107-49119129 GTGCCACAGGCCCAAGGAGAGGG - Exonic
954325565 3:49861564-49861586 GTCCCTCAGGGCCACGGGGAGGG - Exonic
954692647 3:52403881-52403903 GCCCCACAGGTATAAGGGGAAGG - Exonic
956789856 3:72672178-72672200 GTCCCAGAGGACAAAGAGGAGGG + Intergenic
957967078 3:87335982-87336004 TGGCCACAGGACCATGGAGAGGG + Intergenic
961155489 3:124676153-124676175 GGCCAACAGAACCAAAGGTAGGG - Intronic
961482415 3:127192738-127192760 GGCCCACAGGGCCAGAGGGGAGG - Intergenic
961558247 3:127711297-127711319 CCCCCAGAGGACCACGGGGAAGG + Intronic
961785337 3:129343941-129343963 GGTCCAAAGGACCCATGGGAAGG + Intergenic
964176737 3:153832617-153832639 GGAGAACAGCACCAAGGGGATGG + Intergenic
965690540 3:171351964-171351986 AGTCCTCAGGACCAAGGAGATGG + Intronic
965700595 3:171456930-171456952 GTCACACAGTAACAAGGGGAGGG - Intronic
967245250 3:187480132-187480154 GGACCCCAGGACCAACTGGAGGG + Intergenic
969306885 4:6330901-6330923 AGCCCAGGGGCCCAAGGGGAAGG - Intronic
969329481 4:6465215-6465237 TCCCCGCAGGACCAAGGGGTGGG - Intronic
969353666 4:6612858-6612880 GGCCCACATAACCAAGGGAAGGG + Intronic
969498614 4:7540091-7540113 GCCCCACAGCACAAAGGGGGCGG - Intronic
969687346 4:8683081-8683103 GGCCCCCAGGAGCAAGAGGAGGG + Intergenic
973631456 4:52824569-52824591 TGCCTACAGGGCCAGGGGGAAGG - Intergenic
979765826 4:124463139-124463161 GTCCCACAGGGCCATGTGGATGG + Intergenic
982163917 4:152597430-152597452 GGCCCAAAGGGCCAAGGAAAAGG - Intergenic
983682576 4:170370878-170370900 GGCCCTGTGGACCAAGGGCAAGG + Intergenic
984611673 4:181846996-181847018 GGGACACAGGGCCTAGGGGATGG - Intergenic
985675920 5:1231296-1231318 GCCCCACAGGCCCCAGGGCAGGG - Intronic
986105009 5:4651073-4651095 GGCCCACAGGGCCCTGGGGGTGG + Intergenic
986940674 5:12945590-12945612 GGAGGACAGCACCAAGGGGATGG - Intergenic
987289408 5:16494463-16494485 TGAGCACAGCACCAAGGGGATGG - Intronic
988482575 5:31642059-31642081 GGCCCACATGATCAAAGGCAAGG - Intronic
988555881 5:32235668-32235690 GGCCCAGAAGACAACGGGGATGG + Intronic
990302136 5:54459830-54459852 GTCCCCCAGGTCCAAAGGGATGG + Intergenic
991580832 5:68153452-68153474 GGCCCTCAGTATCCAGGGGACGG + Intergenic
993460112 5:88172753-88172775 GGGACAGAGCACCAAGGGGAAGG - Intergenic
996284689 5:121775215-121775237 GGACCTCAGGACAAAGGGGATGG - Intergenic
996658144 5:125966478-125966500 CGCCCACATGACCATGGTGAGGG - Intergenic
998442461 5:142173921-142173943 GGAGAACAGCACCAAGGGGATGG + Intergenic
998575274 5:143308714-143308736 GGGCCACAGGAACAAGAGGAAGG - Intronic
998972732 5:147610790-147610812 GGGACACAGCACCTAGGGGAAGG - Intronic
999341083 5:150773464-150773486 TGAACACAGTACCAAGGGGATGG - Intergenic
1000232927 5:159331935-159331957 GGCCTAGAGGACACAGGGGATGG - Intergenic
1001349581 5:170946567-170946589 GGCCCACAGGAGCAATGGTTCGG - Intronic
1002294305 5:178221673-178221695 GGCCCAGAGGAGGAAGGGCAGGG - Intronic
1002452121 5:179325173-179325195 GGCCCACAGGATGAACGGGAAGG + Intronic
1003196026 6:3915655-3915677 GCCTCACAGGGCCAAGGGAAAGG - Intergenic
1003436195 6:6090832-6090854 GCCTCACAGGGCCAAGGGAAAGG + Intergenic
1003452517 6:6248960-6248982 GGACCCCAGGATCAAGGAGAGGG + Intronic
1003493414 6:6642917-6642939 GGGCCAGAGGACGAAGAGGAAGG - Intronic
1005118860 6:22368737-22368759 GGCCCATCGGACAAAGAGGATGG - Intergenic
1005373302 6:25157014-25157036 GGCCCAGAGGGCCATGGTGATGG - Intergenic
1006351580 6:33525095-33525117 GGCCCAGAGAACAAAGGAGAGGG - Intergenic
1007103999 6:39270920-39270942 GACCCACAGGAAAATGGGGATGG + Intergenic
1007590993 6:43020939-43020961 GGGACAGAGCACCAAGGGGAAGG - Exonic
1010145940 6:72669561-72669583 CCACCACAGGCCCAAGGGGAGGG - Intronic
1011633325 6:89348293-89348315 GGCCCACAGCACCTAGAGCATGG - Intronic
1012230724 6:96758270-96758292 GGAGAACAGCACCAAGGGGATGG - Intergenic
1012407864 6:98921650-98921672 GGCCCACATGACCAAGGTCCAGG + Intronic
1013438680 6:110139262-110139284 GGCCCCCAAGAGCACGGGGATGG + Intronic
1014619755 6:123652255-123652277 TGAACACAGCACCAAGGGGATGG - Intergenic
1015792096 6:136973968-136973990 GGCCCACAGGAACAGTGGCATGG - Intergenic
1018593777 6:165455737-165455759 GGCCCACAAGGCTAATGGGAGGG - Intronic
1018910550 6:168098807-168098829 CGCCCACATGCTCAAGGGGACGG + Intergenic
1019340759 7:507771-507793 GGCACACAGGACAGAGGGGATGG + Intronic
1019569708 7:1705153-1705175 CACCCACAGGGCCAAGGGGTGGG + Intronic
1019955102 7:4407660-4407682 GGGTCACAGGACCACGGAGATGG - Intergenic
1020204713 7:6105365-6105387 GGCCCCCAGGCCGAAGGGGCGGG - Intronic
1023585669 7:41727175-41727197 AGCCCTCAGGACCAAGAGGGGGG + Intergenic
1023642251 7:42271657-42271679 GGTGCACAGGACCAAGGGTCTGG - Intergenic
1023830968 7:44038893-44038915 CATCCACAGGACCAAGGGCAAGG - Intergenic
1025252465 7:57360958-57360980 GGCCCACTGGTCCCAGGAGAAGG + Intergenic
1026764959 7:73154716-73154738 CACCCTCAGGACTAAGGGGAAGG - Intergenic
1027041431 7:74964486-74964508 CACCCTCAGGACTAAGGGGAAGG - Intergenic
1027082209 7:75237890-75237912 CACCCTCAGGACTAAGGGGAAGG + Intergenic
1028998323 7:97126423-97126445 GGGCCACAGCACCTGGGGGAAGG - Intronic
1029390771 7:100272393-100272415 CACCCTCAGGACCACGGGGAAGG + Intergenic
1029460476 7:100691352-100691374 GGTCTACTGGGCCAAGGGGAAGG + Intergenic
1029536866 7:101162466-101162488 ACCACACAGGCCCAAGGGGACGG + Intergenic
1029741302 7:102493202-102493224 CATCCACAGGACCAAGGGCAAGG - Exonic
1029759292 7:102592371-102592393 CATCCACAGGACCAAGGGCAAGG - Exonic
1029776661 7:102688281-102688303 CATCCACAGGACCAAGGGCAAGG - Intergenic
1030274864 7:107709626-107709648 GGCCCACAGCAGCAGGAGGATGG + Intronic
1032328076 7:130950961-130950983 GGCCCACAGGAAAGAGAGGAGGG + Intergenic
1033284589 7:140029855-140029877 GGCCCACAGCAACAAGGAAATGG + Intronic
1034358587 7:150474003-150474025 GTCCCACAGGCCCAAGGGAAAGG + Exonic
1035245218 7:157558775-157558797 GCCCTACAGGAGCAAGGGGGAGG - Intronic
1035420006 7:158719706-158719728 GGCCCAAATGACCAACAGGAGGG + Intergenic
1037503259 8:19505672-19505694 GGCCAACAGCCCCACGGGGAAGG - Exonic
1039512489 8:38103189-38103211 AGCCCACACAATCAAGGGGAGGG + Intergenic
1041678713 8:60564288-60564310 TACCCACAGCACCAAGGGAAAGG - Intronic
1042432846 8:68727850-68727872 GCCCCACAGGCCCAGGAGGATGG - Intronic
1042470620 8:69183394-69183416 GGCCCACAGGAAGGAGGGAAAGG + Intergenic
1042886265 8:73555257-73555279 GGCCAGCAGGAGCAAGGGCAGGG + Intronic
1043978785 8:86614484-86614506 GCCTCACAGGGCCAATGGGAAGG - Intronic
1044706172 8:95010859-95010881 GGCCGTCAAGACAAAGGGGAAGG + Intronic
1045012130 8:97967637-97967659 GGCACACAGGTGCAAGGGGTGGG + Intronic
1045099406 8:98829231-98829253 GGCCCAAAGGGTCAAGGGGAAGG - Intronic
1046923273 8:119757650-119757672 GGCCCAAGGGCCCAAGGGGGTGG + Intronic
1047662457 8:127052374-127052396 AGCCCACAGGATCAAGGGTCAGG - Intergenic
1049393354 8:142383167-142383189 AGGCCACAGGACCTAAGGGAGGG + Intronic
1049419783 8:142511443-142511465 GGCGGAGAGGACCAAGGGAAAGG - Intronic
1049424663 8:142532754-142532776 AGCCCACAGGCCCCAGGCGAGGG - Intronic
1051564419 9:18480987-18481009 AGCACACAGATCCAAGGGGAAGG + Intronic
1052665124 9:31486528-31486550 GACCCACAGGAACAAGAGAATGG - Intergenic
1055589995 9:77802282-77802304 GGCTCACAGGACTCAGAGGAGGG + Intronic
1055841635 9:80512367-80512389 GCCTCACAGGGCCAATGGGAAGG - Intergenic
1056560842 9:87727681-87727703 GGCACAGTGGACCAAGTGGAAGG + Exonic
1057198841 9:93129849-93129871 GGCCCAGAGTACCAAGGTTAGGG - Intronic
1059637009 9:116180864-116180886 GTCCCACAGCACTAAGGGGTAGG - Intronic
1060926522 9:127459196-127459218 ACCCCAAAGGGCCAAGGGGAGGG - Intronic
1061327846 9:129874997-129875019 GGCCCATGGGTCCCAGGGGACGG - Intronic
1061366953 9:130177120-130177142 GGCACACAGGAGCAGGTGGAGGG + Intronic
1187359402 X:18610786-18610808 AGCCCACAGGGCCAAGAGCAAGG + Intronic
1187847246 X:23553203-23553225 GGCCCAAAGGAAAAAGGGAAAGG + Intergenic
1190055276 X:47177947-47177969 GGCCAACAGGATGCAGGGGAGGG - Intronic
1192368901 X:70497499-70497521 GGCCCACAGTACCCATGGCAGGG - Intronic
1194572908 X:95574773-95574795 GGCACACAGCAGCAAGGGGTTGG - Intergenic
1195197814 X:102516621-102516643 GAGCCAGAGGACCATGGGGATGG - Intronic
1195347209 X:103962746-103962768 GAGCCAGAGGACCATGGGGACGG + Exonic
1195360233 X:104076095-104076117 GAGCCAGAGGACCATGGGGACGG - Intergenic
1198201711 X:134426882-134426904 GCACCTCAGTACCAAGGGGAGGG + Exonic
1198309614 X:135417712-135417734 TGACAACAGCACCAAGGGGATGG - Intergenic
1198507220 X:137312730-137312752 AGCCTAAAGGAGCAAGGGGAGGG + Intergenic
1199189263 X:144951438-144951460 GGCACACAGGAGCAAGGGGTGGG + Intergenic