ID: 1161308284

View in Genome Browser
Species Human (GRCh38)
Location 19:3578956-3578978
Sequence AAGCCGGCCCCCACCCATCT GGG (reversed)
Strand -
Crispr in exon? Yes
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 139
Summary {0: 1, 1: 0, 2: 0, 3: 7, 4: 131}

Found 8 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1161308284_1161308298 19 Left 1161308284 19:3578956-3578978 CCCAGATGGGTGGGGGCCGGCTT 0: 1
1: 0
2: 0
3: 7
4: 131
Right 1161308298 19:3578998-3579020 CAGCCGAGGGACCCTGGTGGGGG 0: 1
1: 0
2: 1
3: 21
4: 285
1161308284_1161308292 13 Left 1161308284 19:3578956-3578978 CCCAGATGGGTGGGGGCCGGCTT 0: 1
1: 0
2: 0
3: 7
4: 131
Right 1161308292 19:3578992-3579014 CTCCTCCAGCCGAGGGACCCTGG 0: 1
1: 0
2: 4
3: 23
4: 263
1161308284_1161308295 17 Left 1161308284 19:3578956-3578978 CCCAGATGGGTGGGGGCCGGCTT 0: 1
1: 0
2: 0
3: 7
4: 131
Right 1161308295 19:3578996-3579018 TCCAGCCGAGGGACCCTGGTGGG 0: 1
1: 0
2: 1
3: 10
4: 142
1161308284_1161308290 6 Left 1161308284 19:3578956-3578978 CCCAGATGGGTGGGGGCCGGCTT 0: 1
1: 0
2: 0
3: 7
4: 131
Right 1161308290 19:3578985-3579007 TCCTGCTCTCCTCCAGCCGAGGG 0: 1
1: 0
2: 3
3: 21
4: 282
1161308284_1161308289 5 Left 1161308284 19:3578956-3578978 CCCAGATGGGTGGGGGCCGGCTT 0: 1
1: 0
2: 0
3: 7
4: 131
Right 1161308289 19:3578984-3579006 ATCCTGCTCTCCTCCAGCCGAGG 0: 1
1: 0
2: 3
3: 18
4: 274
1161308284_1161308297 18 Left 1161308284 19:3578956-3578978 CCCAGATGGGTGGGGGCCGGCTT 0: 1
1: 0
2: 0
3: 7
4: 131
Right 1161308297 19:3578997-3579019 CCAGCCGAGGGACCCTGGTGGGG 0: 1
1: 0
2: 1
3: 26
4: 200
1161308284_1161308294 16 Left 1161308284 19:3578956-3578978 CCCAGATGGGTGGGGGCCGGCTT 0: 1
1: 0
2: 0
3: 7
4: 131
Right 1161308294 19:3578995-3579017 CTCCAGCCGAGGGACCCTGGTGG 0: 1
1: 0
2: 1
3: 21
4: 188
1161308284_1161308300 22 Left 1161308284 19:3578956-3578978 CCCAGATGGGTGGGGGCCGGCTT 0: 1
1: 0
2: 0
3: 7
4: 131
Right 1161308300 19:3579001-3579023 CCGAGGGACCCTGGTGGGGGTGG 0: 1
1: 0
2: 2
3: 39
4: 323

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1161308284 Original CRISPR AAGCCGGCCCCCACCCATCT GGG (reversed) Exonic
900389501 1:2427824-2427846 AAGCCGGCTCCCACCCCTGGAGG - Intronic
900537810 1:3187423-3187445 GACCCTGCCCCCACCCGTCTGGG - Intronic
901658187 1:10782574-10782596 CACCCGGCCCCCACCCTGCTGGG - Intronic
901830940 1:11892175-11892197 AAGATGGCCCCCACCTCTCTGGG + Intergenic
903331317 1:22598468-22598490 AATCCAGGCCCCACCCAGCTGGG + Intronic
903652835 1:24931778-24931800 GAGCTGGCCCCTACCCACCTCGG + Intronic
904418384 1:30376255-30376277 AATCAGGCCCCCACCCTTCAAGG + Intergenic
904902407 1:33867854-33867876 AAGAGGGCCCCCACACAGCTAGG + Intronic
905655757 1:39684952-39684974 AAGTCAGCCCCCACCCTCCTTGG + Intronic
906510160 1:46406105-46406127 AGGCCGACCCCCACCCTCCTCGG - Intronic
906521414 1:46469118-46469140 AAGCAGGCCCCCACACACCCAGG + Intergenic
908389285 1:63670368-63670390 TAGCTGGCCGCCAGCCATCTGGG - Intergenic
912445127 1:109729959-109729981 AAGCCGTGCCCCAACCACCTGGG - Intronic
914381675 1:147121905-147121927 AAGCCGTGCCCCAACCACCTTGG + Intergenic
915084660 1:153377320-153377342 AAGCCTGCCCCCACCCAGGTTGG - Intergenic
915256565 1:154635585-154635607 AAGCTGTACCCCACCCACCTTGG - Intergenic
915479409 1:156174923-156174945 CAGCTGGCCCCCACCCAGGTGGG + Exonic
916301297 1:163277317-163277339 AAGCAGTGCCCCACCCATCTTGG + Intronic
921767001 1:218983711-218983733 ACGCCAGCCCCCTTCCATCTGGG - Intergenic
922025441 1:221744141-221744163 AAGCTGGACCCCAACCACCTTGG - Intergenic
923895618 1:238266944-238266966 AAGCTGGCAGCCACCCTTCTGGG + Intergenic
1068809067 10:61235295-61235317 AAGCCGTGCCCCAACCACCTTGG + Intergenic
1069629579 10:69889466-69889488 GGGCCAACCCCCACCCATCTCGG - Intronic
1073212597 10:101817594-101817616 AAGTCTGACCCCACCCGTCTTGG - Intronic
1073871665 10:107871635-107871657 AAACTGGTCCCCACCAATCTGGG - Intergenic
1078490589 11:11764328-11764350 AAGCCTGCCCCCACTCCTCATGG + Intergenic
1079243616 11:18737842-18737864 GAGCCTGCCCCCATCCCTCTGGG + Intronic
1084169408 11:67393413-67393435 ATGCAGGCCCACACCCATCATGG - Intronic
1085988656 11:81813171-81813193 AAGCTGGACCCCAACCACCTTGG + Intergenic
1090938347 11:131365391-131365413 CAGCCTGCCCTCACACATCTGGG - Intergenic
1091218417 11:133917450-133917472 AAGCCTGCCCCCTCCCCTCGGGG + Intronic
1094468347 12:30778711-30778733 AAGCTGTACCCCAACCATCTTGG - Intergenic
1095738867 12:45586253-45586275 TGCCCGGCCCCCAACCATCTGGG - Intergenic
1095738897 12:45586372-45586394 TGCCCGGCCCCCAACCATCTGGG - Intergenic
1096565880 12:52478518-52478540 AAGCTGTTCCCCAACCATCTTGG + Intergenic
1099683448 12:85857129-85857151 AAGCCTCCCGCCACCCAACTAGG + Intergenic
1103735712 12:123059513-123059535 AAGTGGGCCTCCACCCTTCTGGG - Intronic
1104559418 12:129830628-129830650 AAGCTGGGCCCCAACCACCTTGG + Intronic
1105287447 13:19017045-19017067 AAGCTGTACCCCAGCCATCTTGG + Intergenic
1107158483 13:37197886-37197908 CAGTCTGGCCCCACCCATCTTGG - Intergenic
1107468064 13:40666748-40666770 AAACCGGGCCCCACCCAGCCCGG - Intergenic
1110128633 13:71979130-71979152 CAGTCTGGCCCCACCCATCTTGG + Intergenic
1113609355 13:111632287-111632309 AAGCCGCACCCCAACCACCTGGG - Intronic
1114907711 14:27151457-27151479 CAGTCTGGCCCCACCCATCTTGG - Intergenic
1122531670 14:102432139-102432161 TAGCTGGCACACACCCATCTGGG + Intronic
1127731593 15:61807080-61807102 AGACCAGACCCCACCCATCTCGG + Intergenic
1128072854 15:64808102-64808124 AAGCCCCACCCCTCCCATCTTGG + Intergenic
1128732407 15:70030172-70030194 AAGCTGGCCCTCAGCCACCTTGG - Intergenic
1129685891 15:77685978-77686000 CAGCCGCCCACCACCCACCTGGG - Intronic
1131121975 15:89828477-89828499 TAGCCAGCCCACACCCAGCTGGG + Intergenic
1133776989 16:8904344-8904366 AGGTCAGCCCCCACCCCTCTGGG - Intronic
1135229481 16:20692256-20692278 AAGCCGTACCCCAACCACCTTGG - Intronic
1136478541 16:30527287-30527309 CCTCCGGCCCCCACCCAGCTCGG + Intronic
1142012745 16:87725073-87725095 AAGACTGGCCCCACACATCTGGG + Intronic
1142070012 16:88086872-88086894 AGGCGGGCACCCACCCATGTGGG - Intronic
1142310480 16:89309644-89309666 AAGGCGGCTCCCATCCACCTGGG + Intronic
1143527713 17:7482112-7482134 AGGCAGGCCCCCACCCAGCAGGG - Exonic
1146731045 17:35194158-35194180 AGGCAGGCCCCCACCCAGCAGGG + Exonic
1152574075 17:81132565-81132587 CGGCCTGGCCCCACCCATCTGGG + Intronic
1152748135 17:82050602-82050624 CAGGAGGCCCCCACCCAGCTTGG + Intronic
1152757496 17:82093058-82093080 ACGCCGGCCCCCACCCCACCAGG + Intronic
1154115456 18:11609723-11609745 AGGCAGGCCCCCACCCAGCAGGG - Intergenic
1161051234 19:2164880-2164902 AAGCCTGTCCCCAACCAACTAGG - Intronic
1161308284 19:3578956-3578978 AAGCCGGCCCCCACCCATCTGGG - Exonic
1162063754 19:8111988-8112010 AAGCCATCCCCCACCCAGCCTGG + Exonic
1162555604 19:11383916-11383938 ACCCCGCCCCCCACCCATCCAGG + Intronic
1162724363 19:12681127-12681149 CAGCCAGCCCCCACCCTTTTAGG + Intronic
1163636327 19:18438621-18438643 ATGTCCGCCCCCATCCATCTCGG + Intergenic
1163720056 19:18894570-18894592 AAGCCGTCCCCCACCCCTGCGGG - Intronic
1166343074 19:42150282-42150304 AAGCCTTCCACCCCCCATCTAGG - Intronic
1166347558 19:42176042-42176064 AAACCGGCCCCCACACCTCCAGG + Intronic
1167036104 19:46995807-46995829 AAGCTTGCCCTCACCCCTCTAGG - Intronic
925121788 2:1424108-1424130 AAGCTGTGCCCCAGCCATCTTGG - Intronic
926202927 2:10814180-10814202 CAGCCGGCCCCCACCACTCCTGG - Intronic
928840431 2:35598899-35598921 AAGCATGCACACACCCATCTGGG - Intergenic
929111091 2:38405790-38405812 AAGCTGTGCCCCAACCATCTTGG + Intergenic
934112160 2:88754107-88754129 AGGCCAGCTCCCAGCCATCTGGG + Intergenic
934169144 2:89325028-89325050 AAGACAGCCCTCAGCCATCTGGG + Intergenic
934198149 2:89857556-89857578 AAGACAGCCCTCAGCCATCTGGG - Intergenic
941043552 2:160648852-160648874 AAGCCAGCCCCCTGCCACCTAGG + Intergenic
947709872 2:232306956-232306978 AACCCCGTGCCCACCCATCTAGG + Intronic
948992634 2:241562554-241562576 GAGCTGGCCCCCACCCATCCTGG + Intronic
1170816754 20:19720622-19720644 AAGCAGGCCCCCACTCCCCTGGG - Intronic
1173543169 20:43869645-43869667 ACTCCGGTCCCCTCCCATCTTGG - Intergenic
1175993279 20:62800193-62800215 AAGGCCACCCCCACCCACCTGGG + Exonic
1181173398 22:21022780-21022802 AGCCCGGCCCCCACCCTGCTGGG - Intronic
1181308914 22:21933191-21933213 AAGCCTGCCCCGACCCAGCATGG - Intronic
1182108800 22:27708163-27708185 AAGCCAGCCCCCACCAAACATGG - Intergenic
1182112543 22:27733720-27733742 AACCCTGCCCCCACCCAGCAAGG - Intergenic
1182453894 22:30437485-30437507 AAGCTGTGCCCCAACCATCTTGG - Intergenic
1184410586 22:44323769-44323791 AAGGCGGCCTCCACCCTTCCAGG + Intergenic
953922902 3:46964423-46964445 TACCCGGCCACCACCCGTCTGGG + Intronic
954879359 3:53823242-53823264 ACCCCAGCCCCCACCCATCTTGG - Intronic
960946931 3:122973404-122973426 AGGCTGGACCCCACTCATCTTGG - Intronic
962193462 3:133335980-133336002 TAGCCGACACCCACCCATCAAGG + Intronic
962367930 3:134797989-134798011 ACGCTGGCCCCAACCCAGCTAGG - Intronic
967166429 3:186783783-186783805 AATCCGGGCCCTACCCATCATGG - Intronic
971548700 4:27921215-27921237 AAGCTGGCCCCCACCTCTGTAGG - Intergenic
976068407 4:81215293-81215315 AAGCCGGCGCCCAACTATCCAGG - Intergenic
976465746 4:85366927-85366949 AAGCTGGCACCCACCTCTCTTGG + Intergenic
980774531 4:137421295-137421317 AAGCCTGCCCCCACCGCCCTGGG + Intergenic
986220224 5:5762357-5762379 AAGCGGCGCCCCAACCATCTTGG + Intergenic
989133459 5:38130190-38130212 TAACCCACCCCCACCCATCTAGG - Intergenic
992733133 5:79691802-79691824 AAGCTGTCCCCCAACCACCTTGG - Intronic
1002792984 6:449153-449175 GGCCCGGCCCCCACCCATCGCGG - Intergenic
1002884668 6:1282841-1282863 AAGGCTGCACCCACCCACCTGGG + Intergenic
1006580047 6:35071905-35071927 AGGCCGGCCCCTCCCCATCTGGG + Intronic
1018155610 6:160982830-160982852 AAGCTGCACCCCAACCATCTTGG + Intergenic
1018226187 6:161631003-161631025 AAGCGTGGCCCCACCCTTCTGGG - Intronic
1019515315 7:1437460-1437482 GAGCCGGCCCCCAGACATCCTGG + Intronic
1024258523 7:47557394-47557416 AACCCAACCCTCACCCATCTAGG + Intronic
1029192090 7:98779121-98779143 GATCCAGCTCCCACCCATCTGGG + Intergenic
1034450742 7:151135990-151136012 AGGCCGGCCACCACCCATCATGG + Intronic
1034459038 7:151187798-151187820 ATGCTGGGCCCCACCCAGCTCGG - Intronic
1034681693 7:152933825-152933847 AAGCTGTGCCCCAACCATCTTGG + Intergenic
1035246465 7:157565594-157565616 AAGCCTGACCCCACCCAGCATGG + Intronic
1036737490 8:11331234-11331256 AGGCAGGCCCCCACCCAGCAGGG - Exonic
1038672800 8:29595971-29595993 CAGGTGTCCCCCACCCATCTGGG - Intergenic
1043577368 8:81673459-81673481 AAGCCGTACCCCAACCACCTCGG + Intronic
1044222432 8:89685066-89685088 AAGCTGTCCCCCAACCACCTTGG + Intergenic
1046956114 8:120064488-120064510 AAGCTGTGCCCCAACCATCTTGG + Intronic
1049710915 8:144062959-144062981 AAGCCAACCCCCACCCACCCAGG + Intronic
1049996736 9:1042206-1042228 AGGCCGTCCCACACCCATCCCGG - Intergenic
1055645370 9:78357452-78357474 ACGCCAGCCCCCTGCCATCTTGG + Intergenic
1061793392 9:133070516-133070538 TGGTCGGCCCCCACCCATTTGGG - Exonic
1061795999 9:133086313-133086335 TGGTCGGCCCCCACCCATTTGGG - Intronic
1061912823 9:133733975-133733997 AAGCCGGCCCCTGCCCAGCACGG - Exonic
1061961366 9:133990897-133990919 AAGGCGGCCCCTTCCCCTCTGGG + Intronic
1062359776 9:136182243-136182265 AAGCCGGCCCTGCCTCATCTGGG + Intergenic
1062473286 9:136715457-136715479 AAGCCGGCTCCCAGACATCTGGG + Intronic
1062561745 9:137145070-137145092 ACCCCGGTCCCCACCCCTCTGGG - Intronic
1062561767 9:137145127-137145149 ACCCCGGTCCCCACCCCTCTGGG - Intronic
1185544157 X:928682-928704 AAGCCAGGCCCCATCCATCCTGG + Intergenic
1188756442 X:33969198-33969220 ATGCCAGCCCCCTGCCATCTTGG + Intergenic
1189865395 X:45322087-45322109 AAGCTTGCCCACATCCATCTGGG + Intergenic
1191642529 X:63442786-63442808 AAGCTGCACCCCAACCATCTTGG + Intergenic
1192063379 X:67854549-67854571 AAGCTGTGCCCCAACCATCTTGG + Intergenic
1201297607 Y:12477708-12477730 AAGCTGGGCCCCAACCACCTTGG + Intergenic
1201320020 Y:12688174-12688196 AAGCTGGGCCCCAACCACCTTGG + Intergenic