ID: 1161309319

View in Genome Browser
Species Human (GRCh38)
Location 19:3585441-3585463
Sequence TCCCGGGAAGGCGACACCGC GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 55
Summary {0: 1, 1: 0, 2: 0, 3: 2, 4: 52}

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1161309319_1161309338 30 Left 1161309319 19:3585441-3585463 CCCGCGGTGTCGCCTTCCCGGGA 0: 1
1: 0
2: 0
3: 2
4: 52
Right 1161309338 19:3585494-3585516 CGTCTCGGCTGTCGCGCCCTGGG 0: 1
1: 0
2: 0
3: 5
4: 14
1161309319_1161309328 7 Left 1161309319 19:3585441-3585463 CCCGCGGTGTCGCCTTCCCGGGA 0: 1
1: 0
2: 0
3: 2
4: 52
Right 1161309328 19:3585471-3585493 GTTCCCAGATCCCCTTACCCGGG 0: 1
1: 0
2: 2
3: 18
4: 169
1161309319_1161309331 15 Left 1161309319 19:3585441-3585463 CCCGCGGTGTCGCCTTCCCGGGA 0: 1
1: 0
2: 0
3: 2
4: 52
Right 1161309331 19:3585479-3585501 ATCCCCTTACCCGGGCGTCTCGG 0: 1
1: 0
2: 0
3: 3
4: 36
1161309319_1161309327 6 Left 1161309319 19:3585441-3585463 CCCGCGGTGTCGCCTTCCCGGGA 0: 1
1: 0
2: 0
3: 2
4: 52
Right 1161309327 19:3585470-3585492 GGTTCCCAGATCCCCTTACCCGG 0: 1
1: 0
2: 1
3: 14
4: 165
1161309319_1161309337 29 Left 1161309319 19:3585441-3585463 CCCGCGGTGTCGCCTTCCCGGGA 0: 1
1: 0
2: 0
3: 2
4: 52
Right 1161309337 19:3585493-3585515 GCGTCTCGGCTGTCGCGCCCTGG 0: 1
1: 0
2: 0
3: 1
4: 47

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1161309319 Original CRISPR TCCCGGGAAGGCGACACCGC GGG (reversed) Intergenic
901055580 1:6447426-6447448 TGCAGGAAATGCGACACCGCAGG - Intronic
902385581 1:16073663-16073685 CCAGGGGAGGGCGACACCGCGGG + Intergenic
902478810 1:16701211-16701233 TGCAGGAAACGCGACACCGCAGG + Intergenic
902819416 1:18934810-18934832 TCCCGAGCAGGTGACACAGCAGG + Intronic
907247131 1:53115523-53115545 TCCCGAGAGGACGGCACCGCAGG + Intronic
1072010309 10:91297835-91297857 TCCCAGGAAGGCGAAACCTCTGG + Intergenic
1091201944 11:133787816-133787838 GCGTGGAAAGGCGACACCGCAGG + Intergenic
1094191742 12:27705466-27705488 TCCCCTCAAGGCGACACCACTGG - Intergenic
1097174744 12:57136135-57136157 TCCCGGGAAGACCTCACAGCTGG + Intronic
1104951451 12:132442432-132442454 TCCCAGGAAGGCGATGCCCCCGG + Intergenic
1120145960 14:80978602-80978624 TCCCGGGAAGCCCACAGCCCAGG - Intronic
1129158359 15:73732766-73732788 TCCTGGGAAGGCCCCACCACTGG + Intergenic
1136569963 16:31090785-31090807 TCCAGAGAAGGCAACACCGAGGG + Intronic
1138505462 16:57476106-57476128 TCCCAGGGAGGTGACACTGCTGG - Intronic
1143067809 17:4263715-4263737 TCCCGCGATGCCGACCCCGCGGG - Exonic
1146339451 17:32007125-32007147 TCGCGGGAAGGAGACCCGGCAGG + Intergenic
1146757925 17:35449366-35449388 TCCGGGGAAGGCGGGACCGCAGG - Intergenic
1160177672 18:76609151-76609173 TCCCAGGACGGGGACACAGCAGG - Intergenic
1161309319 19:3585441-3585463 TCCCGGGAAGGCGACACCGCGGG - Intergenic
1165871283 19:38975427-38975449 GCCCGGGAAAGCGACGCTGCGGG + Intronic
1165910566 19:39223899-39223921 TGCCGGGAAGGCAGCACCACTGG - Intergenic
1165943755 19:39428891-39428913 TCCTGAGAAGGCGACAGAGCTGG - Intergenic
1166091615 19:40512972-40512994 TCCCGGGCCGACGGCACCGCCGG - Exonic
1202712829 1_KI270714v1_random:27042-27064 TGCAGGAAACGCGACACCGCAGG + Intergenic
936287873 2:111195013-111195035 TCTCAGGCAGGCCACACCGCAGG - Intergenic
947868855 2:233421228-233421250 TCCCAGGAAGGGGACACTGTGGG - Intronic
948694526 2:239726518-239726540 TCACGGGCAGGCCACATCGCAGG - Intergenic
1168943877 20:1735746-1735768 TCCCGGGTGGGCGACGTCGCAGG - Intergenic
1169849604 20:10035071-10035093 TCCCCGGAAGGCGAGCGCGCGGG - Exonic
1175127415 20:56762873-56762895 TTCCAGGAAGGCGACACAGAGGG - Intergenic
1175856034 20:62121803-62121825 TCCCGGGAAGGCGGCGCTTCCGG - Intergenic
1176194447 20:63830935-63830957 CCCCGGGAGGGCGCCCCCGCGGG + Intronic
1184878944 22:47292847-47292869 TCACGGGAAGGAGACTCTGCGGG + Intergenic
963253273 3:143120749-143120771 GCCCGGGAAGGGGACGCAGCGGG - Exonic
969379376 4:6783589-6783611 CCCCGGGAAGGGAAAACCGCCGG + Intronic
981093459 4:140756281-140756303 TCGCGGGGCGGCGACGCCGCGGG - Intergenic
982843849 4:160224666-160224688 TCCCTGCATGGCGACACTGCTGG + Intergenic
986124678 5:4874250-4874272 TCCTGGGAAAGCGACCCCGGTGG + Intergenic
986559989 5:9050837-9050859 TGCCGGGAAGGTGACAACACTGG - Intronic
986608580 5:9546050-9546072 TGCCGGGAAGGCGGCGCCGGTGG - Exonic
997067194 5:130575394-130575416 TCCCTGGAAGGCTTCACCACTGG + Intergenic
997367826 5:133337029-133337051 TCTCGGGAACGGGACACCTCTGG + Intronic
1017842249 6:158231932-158231954 TCCCGGGGTGGCGACGCCGGGGG + Intergenic
1021534964 7:21693293-21693315 TCCCTGGAATGCAACACCGAAGG - Intronic
1022173687 7:27853053-27853075 GACTGGGAAGGCGTCACCGCAGG - Intronic
1033255640 7:139799190-139799212 TCCCGAGAAGCTGACACCACAGG + Intronic
1035024861 7:155818744-155818766 CCCCGGGAAGCCGACCCAGCAGG - Intergenic
1035752055 8:2002918-2002940 GCCCGGGAAGGCGAGGCCGGCGG + Exonic
1036766114 8:11550303-11550325 TCCCGGGAAGGCGCCTCCAGAGG + Intronic
1041167360 8:55102727-55102749 GCCCGGGCCGGCGACGCCGCCGG - Exonic
1041304637 8:56446748-56446770 TCCCGCGAAGGCGTCGGCGCGGG - Intergenic
1052362139 9:27573134-27573156 CCCCGGGAAGGAGACAGCTCGGG + Intronic
1062398734 9:136363282-136363304 TCCCGGGAAGGCCCCGCCCCAGG + Intronic
1189320211 X:40083231-40083253 TCCCTGGGAGGCAAAACCGCAGG + Intronic
1189465682 X:41276231-41276253 TCCCGGGCGGGCCACCCCGCCGG - Intergenic