ID: 1161311695

View in Genome Browser
Species Human (GRCh38)
Location 19:3598078-3598100
Sequence CGGGGAGTTACAGCATGGGG TGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 95
Summary {0: 1, 1: 0, 2: 0, 3: 4, 4: 90}

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1161311686_1161311695 2 Left 1161311686 19:3598053-3598075 CCAGTCGGGAGACGGAAACTGGG 0: 1
1: 0
2: 0
3: 4
4: 50
Right 1161311695 19:3598078-3598100 CGGGGAGTTACAGCATGGGGTGG 0: 1
1: 0
2: 0
3: 4
4: 90
1161311681_1161311695 19 Left 1161311681 19:3598036-3598058 CCTCATAGGCTCACAGTCCAGTC 0: 1
1: 0
2: 2
3: 12
4: 116
Right 1161311695 19:3598078-3598100 CGGGGAGTTACAGCATGGGGTGG 0: 1
1: 0
2: 0
3: 4
4: 90
1161311679_1161311695 30 Left 1161311679 19:3598025-3598047 CCAGGGCGCACCCTCATAGGCTC 0: 1
1: 0
2: 0
3: 5
4: 81
Right 1161311695 19:3598078-3598100 CGGGGAGTTACAGCATGGGGTGG 0: 1
1: 0
2: 0
3: 4
4: 90
1161311680_1161311695 20 Left 1161311680 19:3598035-3598057 CCCTCATAGGCTCACAGTCCAGT 0: 1
1: 1
2: 2
3: 28
4: 226
Right 1161311695 19:3598078-3598100 CGGGGAGTTACAGCATGGGGTGG 0: 1
1: 0
2: 0
3: 4
4: 90

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1161311695 Original CRISPR CGGGGAGTTACAGCATGGGG TGG Intronic
902572327 1:17354694-17354716 AGGGGAGTAACAGGAAGGGGTGG + Intronic
905527360 1:38649173-38649195 TGGGGAGTCACAGCTTGGAGGGG - Intergenic
907445935 1:54507739-54507761 CTGGGAGTCACAGCTGGGGGCGG + Intergenic
909548192 1:76869345-76869367 CGGGAAGCTGCTGCATGGGGTGG + Intronic
911090887 1:94016033-94016055 CAGGGAGGTAGGGCATGGGGTGG - Intronic
916069104 1:161159687-161159709 CGGGGCGTTATGGCATGGCGGGG + Intronic
917443921 1:175090907-175090929 TGGGAAGTTCCAGCCTGGGGAGG + Intronic
919911633 1:202114621-202114643 GGGGAAGTCACAGCGTGGGGAGG + Intergenic
1069361035 10:67641872-67641894 CGGGGAGTGATAGCATTAGGAGG + Intronic
1070487678 10:76946227-76946249 TGGGGAGCTATGGCATGGGGTGG - Intronic
1071009311 10:80919244-80919266 AGGGGTGTTAGAGCATGGTGCGG + Intergenic
1072660431 10:97360466-97360488 AGGGGAGTCACAGGAAGGGGTGG - Intronic
1075286804 10:121194316-121194338 CGGGGAGTTGGGGCATGGGGGGG + Intergenic
1078105993 11:8358258-8358280 GGGGGAGTCCCAGCTTGGGGTGG + Intergenic
1087220526 11:95542025-95542047 CTGGGTGGTACAGAATGGGGAGG + Intergenic
1088173041 11:107018573-107018595 CGCGGAGGGAGAGCATGGGGGGG - Intergenic
1089644086 11:119866481-119866503 CTGGGACTTACAGAATGGGTAGG - Intergenic
1089986854 11:122822626-122822648 CAGACAGTTACAGCAGGGGGAGG + Intergenic
1090362316 11:126182212-126182234 CGGGGAGGGACAGCCTGGGAGGG - Intergenic
1093772331 12:23032436-23032458 CGGGGAGTCCCAGCCTTGGGAGG - Intergenic
1095679484 12:44956839-44956861 CGGGGAGGGATAGCATTGGGAGG + Intergenic
1098052072 12:66464716-66464738 CGTGAAGTGACATCATGGGGTGG + Intronic
1100861048 12:98807467-98807489 TGGGGAGGTACAAAATGGGGAGG + Intronic
1104437121 12:128765375-128765397 CGGGGACACACAGCAAGGGGCGG - Intergenic
1111377803 13:87403227-87403249 CGGGGGGTACTAGCATGGGGAGG + Intergenic
1112580174 13:100671699-100671721 AGGGGAGTCACAGCAAGGAGGGG - Intronic
1116932208 14:50702028-50702050 CTGGGAGCTCCAGCCTGGGGAGG + Intergenic
1124845896 15:33289788-33289810 CTGAGTCTTACAGCATGGGGAGG - Intergenic
1128311272 15:66632944-66632966 CCCTGAGTTACAGCATAGGGAGG - Intronic
1130687804 15:86054229-86054251 GAGGGAGTTACAGCCTGTGGAGG + Intergenic
1134355051 16:13474578-13474600 CATGGAGTTACAGCCTGGTGAGG + Intergenic
1139214451 16:65113612-65113634 CGGGCAGTGACAACATGGAGTGG + Intronic
1145987634 17:29057805-29057827 GGGGGAGTCACAGAGTGGGGAGG + Intergenic
1147135990 17:38434466-38434488 GGAGGAGAGACAGCATGGGGCGG + Intronic
1147748226 17:42709260-42709282 GGGGGAGTTTCAAGATGGGGAGG + Intronic
1149636560 17:58175359-58175381 TGGGGAGTCAGAGCATGGGAGGG - Intergenic
1153999628 18:10472480-10472502 CGGGGAGGGACAGAAAGGGGAGG + Intronic
1160424043 18:78768132-78768154 CGGGGAGCCTCAGCATGGTGGGG - Intergenic
1161106255 19:2445405-2445427 CGGGGGGACACAGCATGGGAAGG - Intronic
1161311695 19:3598078-3598100 CGGGGAGTTACAGCATGGGGTGG + Intronic
1162729845 19:12711665-12711687 GGGGGAGGCACAGCTTGGGGAGG + Intronic
1162937322 19:13987627-13987649 TGGGGAGTTACTGCAAGGGGTGG + Intronic
1163262735 19:16200897-16200919 GGAAGAGTGACAGCATGGGGAGG - Intronic
1163528446 19:17835417-17835439 TGGGGAGTCACAGGATGGGGTGG - Intronic
1167636375 19:50658368-50658390 AGTGGAGTGACAGCTTGGGGGGG + Intronic
925040837 2:732044-732066 GGGGGAGTCACGGCACGGGGGGG + Intergenic
925040844 2:732062-732084 GGGGGAGTCACGGCACGGGGGGG + Intergenic
925040894 2:732200-732222 GGGGGAGTCACGGCACGGGGGGG + Intergenic
925040970 2:732401-732423 GGGGGAGTCACGGCACGGGGGGG + Intergenic
925041026 2:732551-732573 GGGGGAGTCACGGCACGGGGGGG + Intergenic
925041096 2:732735-732757 GGGGGAGTCACGGCACGGGGGGG + Intergenic
925041114 2:732784-732806 GGGGGAGTCACGGCACGGGGGGG + Intergenic
925041184 2:732951-732973 GGGGGAGTCACGGCACGGGGGGG + Intergenic
925041198 2:732985-733007 GGGGGAGTCACGGCACGGGGGGG + Intergenic
925281771 2:2690112-2690134 CTGGGGGCTGCAGCATGGGGAGG + Intergenic
927186340 2:20485197-20485219 TGGGGAGATGGAGCATGGGGAGG + Intergenic
929600972 2:43204321-43204343 GGAGGAGTCACTGCATGGGGTGG - Intergenic
934099682 2:88641083-88641105 CAGGAAGCTACAGTATGGGGAGG - Intergenic
939470662 2:142615982-142616004 CGGGAAGATACAGCTTGGTGCGG + Intergenic
944299634 2:198108479-198108501 GGGGGATTGACAGCATGGAGTGG + Intronic
946157757 2:217818198-217818220 CGGGGAGTCCCAGCCTGGGCCGG - Exonic
1173124846 20:40327069-40327091 CAGGGAGTTATAGGATGGGGTGG - Intergenic
1173599101 20:44280168-44280190 CCGGGAGTGACAGGAAGGGGGGG - Exonic
1176169263 20:63689647-63689669 AGGTGAGTTACAGCAGGGTGGGG + Exonic
1182763801 22:32744056-32744078 GGGGGAGTGAGAGCAAGGGGTGG - Intronic
1183466117 22:37981224-37981246 CCAGGAGTCACAGCTTGGGGAGG + Intronic
1184887298 22:47354175-47354197 CAGGGTGTTTCAGGATGGGGAGG + Intergenic
953075284 3:39564437-39564459 CTGGGAATTGCAGCCTGGGGTGG - Intergenic
961681719 3:128604120-128604142 TGCGGGGGTACAGCATGGGGAGG - Intergenic
968650382 4:1757996-1758018 GGAGGAGTGACAGAATGGGGCGG - Intergenic
980488522 4:133492615-133492637 CTGGGAGTTACAGAATCAGGTGG + Intergenic
982646320 4:158028075-158028097 GGGGAAGTTGCAGTATGGGGAGG - Intergenic
983180002 4:164636516-164636538 AGGGGAGGGATAGCATGGGGAGG + Intergenic
987174966 5:15297954-15297976 CGGGGAGGGATAGCATTGGGAGG + Intergenic
1003146382 6:3513629-3513651 CGGGGACTCAGAGGATGGGGAGG + Intergenic
1008766232 6:54918858-54918880 CGGGGAGTTACACCATTTGAGGG - Intronic
1013359741 6:109382799-109382821 CGCGGAATTACAGCCTGGCGGGG - Intergenic
1018038200 6:159899370-159899392 CTGGCAGTGACAGCCTGGGGTGG - Intergenic
1018469876 6:164085796-164085818 CTGGAACTTCCAGCATGGGGCGG - Intergenic
1018919505 6:168161516-168161538 TGGGGAGGAGCAGCATGGGGAGG - Intergenic
1018987285 6:168647448-168647470 AGAGGAGTTACAGCAAGGGTTGG + Intronic
1027992576 7:85381202-85381224 CCTGGAGTTGCATCATGGGGAGG - Intergenic
1029471614 7:100758353-100758375 CAGGCAGGGACAGCATGGGGAGG - Intronic
1038974979 8:32685294-32685316 TGGGGAGTCACAGCGTGGTGGGG + Intronic
1039411634 8:37359949-37359971 CTGGGAGTGACAGCATGGCTTGG - Intergenic
1039903044 8:41766935-41766957 CGGGTAGATTCAGCAGGGGGTGG - Intronic
1041604774 8:59768690-59768712 CGGGGTGTTCCAGCATAAGGAGG - Intergenic
1042178599 8:66061939-66061961 CGGGGAGTGGCAGCCTGTGGGGG + Intronic
1049583655 8:143423439-143423461 CGGGGAGGGGCAGCACGGGGTGG - Intronic
1057022968 9:91714722-91714744 CCGGGGGTTCCAGCATGCGGGGG + Intronic
1057811688 9:98262216-98262238 CGGGGAGGGAGAACATGGGGAGG - Intergenic
1061412701 9:130429939-130429961 CGGGGAATTTCAGGAGGGGGAGG + Intronic
1061664014 9:132149821-132149843 CAGGAAGTCACAGCATGGTGTGG + Intergenic
1191933471 X:66400448-66400470 CGGGGAGGGATAGCATTGGGAGG - Intergenic
1191933844 X:66404918-66404940 GGGGAAGGTACAGTATGGGGAGG + Intergenic