ID: 1161316287

View in Genome Browser
Species Human (GRCh38)
Location 19:3619089-3619111
Sequence CTCCAGCAGGTCCTCCATGT CGG
Strand +
Crispr in exon? Yes
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 268
Summary {0: 1, 1: 0, 2: 0, 3: 21, 4: 246}

Found 0 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1161316287 Original CRISPR CTCCAGCAGGTCCTCCATGT CGG Exonic
900211742 1:1459637-1459659 CACCAGCAGGTCCTGTGTGTCGG + Intronic
900224551 1:1526937-1526959 CACCAGCAGGTCCTGTGTGTCGG + Intronic
900531356 1:3155046-3155068 CTCCAGGGGGTGCTCCATGTGGG + Intronic
900634820 1:3657845-3657867 CTCCAGCAGCTCCTCTACCTGGG + Intronic
900922318 1:5681049-5681071 CTCCAGCAAGGCCTCCAAGCAGG - Intergenic
900997777 1:6131722-6131744 CTCCAGGAGGTCCAGCATCTTGG + Exonic
901816116 1:11794448-11794470 CTTCAGCAGCTCCTCCTTGGGGG + Exonic
901822145 1:11837117-11837139 CTGCAGGAGGTCCTCCTTCTCGG - Exonic
901877157 1:12173453-12173475 CTCCACCATGTCCTTCATGAAGG - Intronic
902233632 1:15044017-15044039 CTCCAGCAGGTCCTTCTCCTTGG - Exonic
902503282 1:16924400-16924422 GGCCAGCAGGTCCTCCACGCGGG - Exonic
903034889 1:20486774-20486796 CTCCCGCAGGGCCTCCAGGAGGG + Intergenic
904026838 1:27509357-27509379 ATGCAGCAGGTACTCAATGTTGG + Intergenic
905010151 1:34741800-34741822 GTCCTCCAGGTCCTCCAGGTTGG - Intronic
905129958 1:35746881-35746903 ATCCAACAGCTCATCCATGTTGG + Exonic
913307816 1:117450943-117450965 CCCCAGCAGGTACTCTGTGTTGG - Intronic
915566482 1:156716453-156716475 CTCCAGCATATTCTCTATGTTGG + Intergenic
915754613 1:158248049-158248071 CTCCAACAGGTGTCCCATGTGGG + Intergenic
916286320 1:163109452-163109474 CCCCAGTAGGCACTCCATGTGGG + Intergenic
919887602 1:201946275-201946297 CTCCAGCAGGCTGTCGATGTCGG + Exonic
920028637 1:203021263-203021285 CTCAAGCAGTTCTTCCACGTCGG + Intronic
920389793 1:205592258-205592280 CTGCAGCGAGTCCTCCGTGTAGG - Exonic
920884144 1:209910299-209910321 AGCCAGCATGTCCCCCATGTGGG + Intergenic
921389486 1:214604298-214604320 GTCCTGCAAGTCCTCCATGCAGG + Intronic
922573669 1:226648038-226648060 TTCCAGAGGGTCCTACATGTGGG + Intronic
922659571 1:227418250-227418272 CTCCAGCTGGTCCTGCAATTAGG + Intergenic
1063125378 10:3132381-3132403 CTCCGTCAGGTGCTCCACGTTGG - Exonic
1064716468 10:18181853-18181875 CTCCAGCAATTCTCCCATGTTGG + Intronic
1065534249 10:26701739-26701761 CCCCAGCAGGGACTCCGTGTGGG - Intronic
1065988342 10:30980283-30980305 CTCCAGTCAGTCCTCCATATAGG - Intronic
1069409530 10:68139091-68139113 AGCCAGCAGCTGCTCCATGTTGG - Intronic
1070825537 10:79388369-79388391 CTCCAACAGCTCCTCCATCTGGG + Intronic
1071094100 10:81952991-81953013 CTGCAGCAGGCCCTGCAAGTTGG + Intronic
1074057875 10:109938927-109938949 CTCAAGCAGTTCTTTCATGTGGG - Intergenic
1074149424 10:110744990-110745012 CTCCAGCACTTCCTCCCTGGGGG + Intronic
1074223655 10:111462399-111462421 CTCCAGTAGGGACTCCGTGTGGG - Intergenic
1075468618 10:122671232-122671254 CTCCAGCATTTGCTCCATCTGGG + Intergenic
1076769681 10:132656212-132656234 CTCTAGGAGTTCCTCCAGGTGGG - Intronic
1077148649 11:1057873-1057895 GTCCTGCAGTTCATCCATGTCGG + Intergenic
1079196822 11:18335792-18335814 CTTCAGCTGGTCCTACATGCAGG + Exonic
1080668560 11:34356864-34356886 CTCCACCAGGTTCTCCATGCAGG + Exonic
1081157811 11:39716347-39716369 CTCCAGTAGGGACTCTATGTGGG - Intergenic
1082110842 11:48272058-48272080 GTGCAGCAGGACTTCCATGTGGG - Intergenic
1083410833 11:62491246-62491268 CTCCAGCTCACCCTCCATGTGGG + Intronic
1083550020 11:63580863-63580885 CTTCAGCTGGTCCTCCGTTTGGG - Intronic
1083609070 11:63996606-63996628 ATCCAGCAGTGCCTCCAAGTGGG - Exonic
1083668379 11:64287251-64287273 CTCCAGCTCGCCCTCCATGGTGG - Intronic
1083675256 11:64321577-64321599 TTCCGGCAGGTTCTCCATGGTGG + Exonic
1084884520 11:72195069-72195091 CTCCAGCAGGAGCTCCCTTTTGG + Intronic
1084966123 11:72745611-72745633 CTCCAGTGGGTACTCCATGCGGG - Intronic
1091887524 12:4027466-4027488 CTCCTTCAGGTCACCCATGTGGG - Intergenic
1092471606 12:8786626-8786648 CCCCAGAAGGGACTCCATGTGGG + Intergenic
1093464929 12:19439716-19439738 CTCCTCCAGGTCGGCCATGTCGG - Exonic
1093967236 12:25340562-25340584 CCCCAGCAGGAACTCTATGTGGG + Intergenic
1095928787 12:47605738-47605760 CCCCAGCAGGGACTCCATGTGGG + Intergenic
1096290588 12:50339248-50339270 CTCAAGCAATTCCTCCATTTTGG + Intronic
1096549703 12:52364101-52364123 CTCCACCAGGGCCTCCACATTGG + Exonic
1097144048 12:56927624-56927646 CACCATAAGGTCCTCCAAGTCGG + Intronic
1100882020 12:99029823-99029845 CTCCACCATGTTCTCAATGTGGG + Intronic
1101438034 12:104680622-104680644 CTCCTGCACCTGCTCCATGTGGG + Intronic
1102823565 12:115927605-115927627 CTCCAGGAAGTCTTCCATGCTGG - Intergenic
1103725334 12:122994915-122994937 TTCCAGCAGCTCCACCATGCTGG - Exonic
1104259352 12:127168380-127168402 TTCCAGCAGTTGCTCCATGAAGG + Intergenic
1104363252 12:128153584-128153606 CTCCACCAGGTCCCTCATGTTGG + Intergenic
1104675960 12:130712587-130712609 CTCCGGCAGGTCCTTCAGGAGGG - Intronic
1107234137 13:38148265-38148287 CACCACCACTTCCTCCATGTAGG + Intergenic
1113737394 13:112688785-112688807 CTGCAGCAGGTTGTCCCTGTGGG + Intergenic
1114258761 14:21023298-21023320 CTCCTGCAGCTCCGCCATGGTGG + Exonic
1114635506 14:24184702-24184724 TTCCCGCAGGTGCTCCATGATGG + Exonic
1117372585 14:55092287-55092309 CTCAAGCAGTCCTTCCATGTCGG + Intergenic
1117741982 14:58828123-58828145 CTCCAGAATGGCCTCAATGTGGG + Intergenic
1118524255 14:66621984-66622006 CCCCAGTAGGAACTCCATGTGGG + Intronic
1121455971 14:94039039-94039061 CCCCAGCAGGGACTCCAGGTAGG - Exonic
1122293153 14:100690281-100690303 CTCCAGGAGGTGCTGCAGGTGGG + Intergenic
1122863691 14:104593989-104594011 CTCCAGCAGCTCCGGCCTGTCGG + Intronic
1202857883 14_GL000225v1_random:63123-63145 CGCCACCAGGCCCTCCATGGTGG + Intergenic
1123476802 15:20596666-20596688 CTCCAGCAGCTTCTGCACGTTGG + Intergenic
1123641209 15:22403698-22403720 CTCCAGCAGCTTCTGCACGTTGG - Intergenic
1123724520 15:23088698-23088720 ATCCAGCCGGGTCTCCATGTTGG - Intergenic
1123815195 15:23971137-23971159 CTCAAGCAGGTGCCCTATGTAGG - Intergenic
1124374387 15:29121172-29121194 CCCCAGCAGTGCCTCCCTGTAGG - Exonic
1124477136 15:30045018-30045040 CACCAGCACGTCCTCCGGGTCGG - Intergenic
1125598579 15:40903085-40903107 CTCCAGCCGGGCCTGCTTGTAGG - Exonic
1125682061 15:41537160-41537182 CTCCAGCAGTGTCTCCGTGTGGG + Exonic
1126686108 15:51250320-51250342 CCCCAGGAGGTGCTCCATGTGGG + Intronic
1127284708 15:57522208-57522230 CTTCAGCAGGTCGGCCACGTTGG + Intronic
1128332096 15:66762579-66762601 TTCCAGCAGGTCCTTCTTGCTGG - Intronic
1128744752 15:70105780-70105802 CTCTGGCAGCTCCTCCAAGTGGG + Intergenic
1129775700 15:78234981-78235003 CTCCCCCAGGTCCTGCATGGAGG + Intronic
1131426522 15:92349748-92349770 CACCACCAAGTCCTCCCTGTGGG + Intergenic
1133299917 16:4776163-4776185 CTGCAGCAGGTCCTCCACCCTGG + Intergenic
1135688850 16:24520310-24520332 CTCCACCACGTACTCCATGAAGG - Intergenic
1136548977 16:30971702-30971724 CTCCAGCAAGGCCTGCAGGTAGG + Exonic
1136627721 16:31472184-31472206 CTCACCCAGGTCCTCCATGGCGG - Exonic
1137761494 16:50944514-50944536 CTCCAGGATGTCCTGCATTTAGG - Intergenic
1138836214 16:60438620-60438642 CTCCAGTTTTTCCTCCATGTAGG + Intergenic
1139388463 16:66589475-66589497 CCCCTGCAGGTCCTTCAGGTGGG + Intergenic
1143378930 17:6483694-6483716 CTCCTGCTGGTCCTGCATGGGGG - Exonic
1143670594 17:8393218-8393240 CTCCCGCTGGCCCTCCATGCTGG - Exonic
1143863652 17:9908776-9908798 CTCAAGCAGGAGCTCCATCTTGG + Intergenic
1144666135 17:17103430-17103452 CTCCACCAGGACCTCCAATTAGG - Intronic
1145277791 17:21445098-21445120 CCCCAGGAGGTCCTGCACGTAGG - Intergenic
1145315621 17:21730977-21730999 CCCCAGGAGGTCCTGCACGTAGG - Intergenic
1145819043 17:27817261-27817283 ATCCAGCAGCTGCTCCATCTGGG + Intronic
1146122664 17:30209213-30209235 CTCCAGCAGCTTCACCACGTAGG + Exonic
1146445970 17:32933257-32933279 CTCCAGAATGGCCTCAATGTGGG - Exonic
1146686726 17:34846060-34846082 TCCCAGCAGGTCATCCCTGTGGG + Intergenic
1147545272 17:41396465-41396487 CTCCACCTGGGCCTCCAGGTCGG + Exonic
1147548714 17:41422823-41422845 CTCCTGCTGGGCCTCCAGGTCGG + Exonic
1147550671 17:41439248-41439270 CTCCTGCTGGGCCTCCAGGTCGG + Exonic
1147597695 17:41727415-41727437 CTCCCGCAGGTCCTGCAGCTGGG + Intronic
1149204522 17:54228212-54228234 CTCCAGTAGGGACTCCATGTGGG - Intergenic
1149683424 17:58521084-58521106 ATCCTTCAGGTCCTGCATGTGGG + Exonic
1149995718 17:61405088-61405110 CTCCAGCAGCTCCTCCGACTCGG + Intronic
1151455950 17:74225907-74225929 CTCCAGCTGGGCCTCCCTGATGG - Intronic
1151698620 17:75730930-75730952 CTCCAGCAGCTCCACGATGTTGG - Exonic
1152330695 17:79671002-79671024 CTCCAGGAGGTCCTCCTGGCAGG + Intergenic
1152738565 17:82009083-82009105 CTGCAGCCGCTCCTCCAGGTCGG - Exonic
1152773966 17:82188335-82188357 CTCCTGCAGCTGCTCCACGTGGG + Exonic
1154255951 18:12780925-12780947 ATACAGGCGGTCCTCCATGTTGG - Intergenic
1157111019 18:44820412-44820434 CACCTGCTGGTCCTCTATGTGGG + Intronic
1157330415 18:46700020-46700042 CTCCAGCATGACCCCCATCTGGG + Intronic
1158383300 18:56959861-56959883 CTGGAGCCAGTCCTCCATGTAGG - Intronic
1159319614 18:66830282-66830304 CTCCAGTGGGACCTCTATGTGGG + Intergenic
1159765254 18:72481044-72481066 CTCCAGTAGGTACTCTGTGTGGG - Intergenic
1160491138 18:79337379-79337401 CTGCAGCTGGTCCTCCACGCCGG - Exonic
1161197509 19:2995065-2995087 CTCCACCATGTCCCCCTTGTTGG - Exonic
1161316287 19:3619089-3619111 CTCCAGCAGGTCCTCCATGTCGG + Exonic
1161483713 19:4523729-4523751 GTCCACCAGGTCCGCCAGGTCGG + Exonic
1161483741 19:4523831-4523853 CTCCAGCAGCTCGTCCACGCAGG + Exonic
1161766925 19:6213385-6213407 CTCCACCAGCTCATCCGTGTAGG + Exonic
1165026842 19:32968587-32968609 GTCCAGCAGGTCCTCCAAAAAGG + Intronic
1165153581 19:33774528-33774550 ATCCAGCAGTTCCTCCACCTGGG - Intergenic
1165153586 19:33774552-33774574 ATCCAGCAGTTCCTCTATCTGGG - Intergenic
1165153596 19:33774600-33774622 ATCCAGCATTTCCTCCATCTGGG - Intergenic
1165153608 19:33774647-33774669 ATCCAGCAGCTCCTCCACCTGGG - Intergenic
1167467888 19:49659681-49659703 CTCCACCAAGTCCTGCAGGTAGG + Exonic
925615231 2:5739034-5739056 CTCCAGCATGTGCTCCTTGGAGG - Intergenic
926248960 2:11142389-11142411 GTCCAGCAGGTCCACAATGCAGG - Intronic
927939175 2:27093015-27093037 CTCATGCACGCCCTCCATGTTGG + Intronic
928349154 2:30531337-30531359 TACCAGGAGGTCTTCCATGTAGG + Intronic
928533340 2:32215158-32215180 GTCCAGCAGACACTCCATGTTGG - Intronic
929255187 2:39802786-39802808 TTCCAGCACTTCCTGCATGTGGG + Intergenic
929370886 2:41222813-41222835 CTCCTGCAGGTCCCCCAAGGAGG - Intergenic
929977774 2:46652055-46652077 CTACAGCAGGTGCTCTAGGTTGG - Intergenic
931345299 2:61440302-61440324 CTCCAGCAGGACCACCAGGGAGG - Intronic
932105282 2:68936306-68936328 CCCCTCCAGGTCTTCCATGTGGG - Intergenic
932258231 2:70305030-70305052 CTCCAACAGCTCCTACTTGTAGG + Intergenic
934678537 2:96266346-96266368 CACCAGCGAGTCCTTCATGTCGG - Exonic
942386511 2:175449014-175449036 CTCCAGGAGGCCCTCTTTGTGGG - Intergenic
947967054 2:234290502-234290524 CTCCAGGAGGTCCACCATGAAGG - Intergenic
948961952 2:241346168-241346190 CTCCTGGAGATCCTGCATGTGGG - Exonic
1172697268 20:36831407-36831429 CGCCAGCAGGAACTCCATGTGGG + Intronic
1172697446 20:36832333-36832355 CTCCACCATGTCCTCCACCTGGG + Intronic
1173878087 20:46389158-46389180 ATCCAGCCGGGTCTCCATGTTGG + Exonic
1174138924 20:48399266-48399288 CTCCAGCAGGAGCTCCTTGCTGG + Intergenic
1174476632 20:50800433-50800455 CCTCAGCAGCTCCTCCATCTGGG - Intronic
1177741160 21:25155048-25155070 CTCCAGTAGGGACTCCGTGTGGG - Intergenic
1178069359 21:28945818-28945840 CTTCATCATGTGCTCCATGTTGG - Exonic
1178334794 21:31733049-31733071 CTCCAGCTGGTCCTCCTTCGGGG - Intergenic
1178493147 21:33067166-33067188 CCCAAGCATGTCCTCAATGTGGG + Intergenic
1178688052 21:34726939-34726961 CTCCAACAGGGCATCCATTTCGG - Intergenic
1179549857 21:42137177-42137199 GACCAGCAGGTCCTCCTGGTGGG - Intronic
1180750012 22:18118021-18118043 CATCAGGAGGTCCTCGATGTCGG + Intronic
1181878027 22:25955306-25955328 CTGCACCAGCTCTTCCATGTCGG - Exonic
1182909823 22:33972828-33972850 GTCCAGCAGGACTGCCATGTAGG + Intergenic
1184785289 22:46668603-46668625 CGCCAGGAGGGCCTCCAGGTCGG - Intronic
949284679 3:2388130-2388152 CTGCAGAAGGTCCTTCAAGTGGG + Intronic
954093595 3:48304267-48304289 CTCCAGCAGATCCACCCTGCAGG - Intergenic
954323445 3:49847770-49847792 CTCCTGCAGGTACCCCAAGTTGG + Intronic
958795152 3:98699313-98699335 ATCCAGCAGGTATTCCCTGTGGG - Intergenic
958803483 3:98782511-98782533 CCCCAGGAGGTCCTGCACGTAGG + Intronic
959427831 3:106215086-106215108 CTTCAGCAGATCTTCAATGTTGG + Intergenic
961549140 3:127657452-127657474 CTCCCGCAGCTTCTCCCTGTTGG + Intronic
961989800 3:131176236-131176258 CTCCACCAGCTTCTCCATCTTGG - Intronic
963085501 3:141431760-141431782 CTCCAGCAGCTTCCCGATGTTGG + Intronic
963878311 3:150501148-150501170 CTCCAAGAGGTTCTCCATGAGGG + Intergenic
964726439 3:159818743-159818765 CTAGAGCAGGGCCTCCATGCTGG - Intronic
967303701 3:188040968-188040990 ATCTAGCAGGTCGTCCATGCTGG + Intergenic
969203325 4:5622860-5622882 CTCCTGCAGCTCCTCCAGGGTGG + Exonic
969310086 4:6347967-6347989 CTCCGTAAGGTCCTCCATGTTGG + Exonic
971254719 4:25003823-25003845 AGCCAGTACGTCCTCCATGTTGG + Exonic
974341112 4:60615995-60616017 CTCCAGTAGGGCCTCTGTGTGGG - Intergenic
975627815 4:76367365-76367387 CTCCAGCAGTTCGTCCATGCTGG + Exonic
985158949 4:187024200-187024222 CTCCAGGTGGTGCTCCCTGTTGG - Intergenic
985610201 5:883666-883688 CTGCAGCAGGGCCTCCATCAAGG + Intronic
985936791 5:3103459-3103481 CCCCAGCAGGTCCCCCAGGATGG + Intergenic
986021944 5:3812712-3812734 CCTCAGTAGGTCCTCCATGAAGG + Intergenic
987322063 5:16779194-16779216 AACCAGCAGATCCTCCATTTTGG - Intronic
989046973 5:37283085-37283107 CTCCAGTAGGGACTCTATGTGGG + Intergenic
992781526 5:80132495-80132517 GTCCAGGAGGTGCTCCAGGTTGG - Intronic
993902409 5:93593586-93593608 CTCCTGCAGGCTCTCGATGTGGG - Exonic
994043407 5:95283940-95283962 CTCCAGCAGCTGCTCCAGGCAGG + Exonic
994460825 5:100066301-100066323 CTGCAGCATCTCCTCCGTGTAGG + Intergenic
994484970 5:100379726-100379748 CTGCAGCATCTCCTCCGTGTAGG + Intergenic
994494118 5:100488538-100488560 CTCCAGTAGGTACTCTGTGTGGG + Intergenic
995598044 5:113767961-113767983 CCCCAGCAGGGACTCCATTTGGG - Intergenic
996011221 5:118483513-118483535 CCCCAGCAGGGACTCCATTTGGG + Intergenic
997243364 5:132324943-132324965 CACCAGCAGTGCCTCTATGTAGG - Intronic
998586638 5:143433862-143433884 CTTCAGCAGTTCCTCCCTGCAGG + Intronic
998880287 5:146638372-146638394 CTCCGTGAGCTCCTCCATGTTGG + Exonic
1001292728 5:170475660-170475682 CTGCAGCAGGGCCTCTTTGTGGG + Intronic
1002198318 5:177513035-177513057 CTCGAGCAGGTACACCATCTTGG + Exonic
1002513721 5:179741216-179741238 CTCCAGCAGGACTTCAATGTTGG - Intronic
1002535847 5:179874940-179874962 GCCCAGCAGCTGCTCCATGTTGG + Exonic
1002930700 6:1632906-1632928 CTCCAGCAATGCCGCCATGTTGG - Intronic
1003227976 6:4223585-4223607 CTCCAGGAGGGACTCCATGTGGG - Intergenic
1004150945 6:13119663-13119685 CTCCAGCAGGTCATCCCTGAAGG + Intronic
1005081529 6:21961242-21961264 CTCCAGCAATCCTTCCATGTTGG + Intergenic
1005628041 6:27681767-27681789 CTCCAGGAGGTCTTCCTTGATGG - Intergenic
1007185943 6:39972402-39972424 CCCCAGTAGGGACTCCATGTGGG - Intergenic
1012161304 6:95888624-95888646 CCCCAGTAGGGACTCCATGTGGG + Intergenic
1012565060 6:100638666-100638688 ATCCAGTAGGTGCTCCAAGTAGG + Exonic
1014735559 6:125092098-125092120 GTCCAGCAGGACCTACCTGTTGG - Exonic
1017143837 6:151216204-151216226 CCCCAGCAGGTCTTCCAGGGTGG + Intergenic
1017587807 6:155946784-155946806 CTGCAGCAGGTGCTCCAGATGGG - Intergenic
1017720970 6:157242892-157242914 CCCCTGCAGGTCCCACATGTGGG + Intergenic
1018081902 6:160266386-160266408 CACCAGCAGGTAGTCCATGTGGG + Intronic
1018624183 6:165761428-165761450 GTCCAGCAGCCCCTCCATGCGGG + Intronic
1018857857 6:167688309-167688331 CTCCAGGAGGACCCCCATGAAGG - Intergenic
1019713117 7:2526360-2526382 CTGCTGCAGGTTCTCCAGGTGGG - Exonic
1022950954 7:35337442-35337464 CTCCAGCAGTTCCTCAGTTTGGG - Intergenic
1024416018 7:49107954-49107976 CCCCAGTAGGGACTCCATGTGGG - Intergenic
1027624785 7:80532225-80532247 CCCCAGTAGGGACTCCATGTGGG - Intronic
1028581867 7:92417250-92417272 CTCCAACAGGGCCTCCACATAGG + Intergenic
1029707838 7:102285088-102285110 CTCCATCAGTTCCTCCTTGTGGG + Intronic
1031401583 7:121330137-121330159 CTCCAGCTGGTCACCCACGTAGG - Intronic
1032742855 7:134756635-134756657 ATCATGCAGGTCCTCAATGTGGG - Intronic
1034293463 7:149950298-149950320 CTCCAGCAGGTGCTCCCTGCAGG - Intergenic
1034445306 7:151111065-151111087 GTCCAGCAGGCTCTCCAAGTTGG - Intronic
1034498012 7:151433532-151433554 CCCCAGCAGGTGCTCCAGGCTGG - Intronic
1034812602 7:154146555-154146577 CTCCAGCAGGTGCTCCCTGCAGG + Intronic
1035255222 7:157621486-157621508 CTTCAGGTGGTCCTCCATGTAGG + Exonic
1035293767 7:157856001-157856023 CTCCACCCGGTCCGCCGTGTGGG - Intronic
1035756105 8:2034197-2034219 CTCCACCTGGGCCTCCATCTGGG + Intergenic
1036659745 8:10700269-10700291 CTCCTGCAGGAGCTCCATCTGGG - Exonic
1037812709 8:22096445-22096467 CTGCAGCAGGTACTCCAGGCAGG - Exonic
1040991755 8:53359225-53359247 CTCAAGCAGGTCCTTCAGGAGGG - Intergenic
1042778942 8:72468391-72468413 CTCCTCCAGGGCCTCCATTTGGG - Intergenic
1046187155 8:110735335-110735357 CTGCAGCAGGTGCTCCAGATGGG + Intergenic
1046308172 8:112398266-112398288 CTCCAGTAGGTCCAGAATGTGGG - Intronic
1047630323 8:126699700-126699722 CCCCAGCAGGGACTCTATGTGGG - Intergenic
1048067113 8:130981557-130981579 CTCCTGCAGCTCCTCCAGGCTGG + Intronic
1048256799 8:132910999-132911021 ATCCACCAGCTCCTCAATGTTGG - Intronic
1048326600 8:133443850-133443872 CTCCATCAGGGCCTCATTGTAGG + Intergenic
1049302177 8:141877351-141877373 CACCAGCAGGTCCTTCCTGGGGG - Intergenic
1049529399 8:143146897-143146919 CTCTAGCTGGGCCTCCATCTCGG - Intergenic
1049643793 8:143727244-143727266 CTCCAGCAGCTCCGCCACCTTGG + Exonic
1049683880 8:143931543-143931565 CTGCAGCAGGTCCTCCAGCCGGG + Exonic
1052838988 9:33275207-33275229 CCCCAGTTGGTCCTCCATATGGG - Intronic
1052865510 9:33462545-33462567 AGCCAGCAGGCCCTCCATGGAGG + Exonic
1056546079 9:87614987-87615009 CTCCAGCTGGTACTCCAAGACGG + Intronic
1056793101 9:89638918-89638940 CGCTAGCAGGTCCTCCAAGAGGG - Intergenic
1057334966 9:94148383-94148405 CTCCTGTAGCTCCTCCCTGTGGG - Intergenic
1061015508 9:127979082-127979104 CTCAAGCAAGTCTTCCACGTAGG + Intronic
1061676035 9:132216168-132216190 ACCCAGCAGGTGCTCCATGCCGG + Intronic
1061678857 9:132232711-132232733 CCCCACCAGGTCCTCCCTGCAGG - Intronic
1061952853 9:133945857-133945879 CCACAGCAGGTGCTCCAGGTGGG + Intronic
1061953850 9:133951404-133951426 CTCCAGCAGGAGCTCCAAATGGG - Intronic
1186198020 X:7129474-7129496 CTACAACATGTCCTCCATGGAGG - Intronic
1188676476 X:32947126-32947148 GTCCAGCATATCCTCCATGCAGG + Intronic
1192501601 X:71657523-71657545 CATCAGCAGATTCTCCATGTAGG - Intergenic
1192508667 X:71708397-71708419 CATCAGCAGATTCTCCATGTCGG - Intergenic
1192511976 X:71726301-71726323 CATCAGCAGATTCTCCATGTAGG + Intergenic
1192514721 X:71755204-71755226 CATCAGCAGATTCTCCATGTAGG - Intergenic
1192518030 X:71773156-71773178 CATCAGCAGATTCTCCATGTCGG + Intergenic
1192528004 X:71864169-71864191 CTTCAGCAGATTCTCCATGTTGG - Intergenic
1199354796 X:146849508-146849530 ATTCATCAGGTCCACCATGTCGG - Intergenic