ID: 1161316866

View in Genome Browser
Species Human (GRCh38)
Location 19:3621296-3621318
Sequence CCGCCCACACAGCGGGGCAC AGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 143
Summary {0: 1, 1: 0, 2: 1, 3: 12, 4: 129}

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1161316859_1161316866 -4 Left 1161316859 19:3621277-3621299 CCTGTGGGGTCATGGGGCCCCGC 0: 1
1: 0
2: 0
3: 12
4: 128
Right 1161316866 19:3621296-3621318 CCGCCCACACAGCGGGGCACAGG 0: 1
1: 0
2: 1
3: 12
4: 129

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1161316866 Original CRISPR CCGCCCACACAGCGGGGCAC AGG Intronic
900333136 1:2146516-2146538 CTGCACACACAGCGTGGCAGTGG + Intronic
900397954 1:2460988-2461010 CCGGCCCCAGAGAGGGGCACTGG - Intronic
900544026 1:3218514-3218536 CCGCCCGCACAGGTGGGCATCGG + Intronic
901278711 1:8014155-8014177 CCGTTCACAAAGAGGGGCACAGG + Exonic
901670077 1:10850856-10850878 CCAGGCACACAGCAGGGCACAGG + Intergenic
902616188 1:17624776-17624798 CCACCCACTCACCAGGGCACAGG - Intronic
903789202 1:25881196-25881218 CCGCACACACAGGTGGCCACAGG + Intergenic
904604338 1:31690645-31690667 CTGCCATCACAGAGGGGCACGGG - Intronic
905741256 1:40373643-40373665 CCGCCCCCACCGCGCCGCACTGG - Intronic
906719333 1:47994269-47994291 ACGCCCGCTCAGCGGGGCAAGGG - Exonic
912321778 1:108720382-108720404 CTGCCGACACAGCGAGGCACAGG + Intronic
915937237 1:160096692-160096714 CAGGCCACACAGCTGGGCATGGG - Intronic
1063426758 10:5956417-5956439 CAGCCCACACAGCAGGACAGTGG + Exonic
1064316714 10:14264235-14264257 CAGCCCACAAAGCAGAGCACAGG + Intronic
1065259840 10:23913211-23913233 CCTCCCAGACTGCAGGGCACAGG + Intronic
1070774899 10:79103738-79103760 TCGCCCACACAGCCTGGCTCCGG - Intronic
1072686548 10:97540874-97540896 CCGCCCACACAGCCTGGCTGGGG - Intronic
1072807584 10:98434206-98434228 CTGCCCACACAGCTGGGAAAGGG + Intronic
1074113455 10:110438443-110438465 CCACCCACCCAGCTGGGCTCAGG + Intergenic
1075461860 10:122621708-122621730 CAGCACAGACAGCGGGGCAGAGG + Intronic
1075800888 10:125152452-125152474 CCCCCCACACCGCGAGTCACAGG + Intronic
1076722485 10:132398803-132398825 CCGCCCACGGAGCCGGGCGCTGG + Intronic
1076767939 10:132646776-132646798 CGGCCCACAGAGCGTGGCAGCGG - Intronic
1076998633 11:311257-311279 CCGCCCACCCCGCGGGGGTCTGG - Intronic
1077000110 11:318502-318524 CCGCCCACCCCGCGGGGGTCTGG + Intergenic
1077035898 11:494340-494362 CCACCCACACTGGGGAGCACAGG - Intergenic
1079402725 11:20118750-20118772 CCTCCCACACAGCCGGCCACAGG + Intronic
1080802104 11:35618659-35618681 CCGCCGCCACCGCGGGGCTCTGG + Exonic
1082026799 11:47578627-47578649 CCGCCCCCAGGCCGGGGCACTGG + Intronic
1083707277 11:64525208-64525230 CCCCCCGCACATCTGGGCACAGG + Intergenic
1084033532 11:66494528-66494550 CAGCCCACACAGCAGGGGTCAGG - Intronic
1084297422 11:68222000-68222022 CCCCCCACACTGGGGGGGACGGG - Intergenic
1084577428 11:69998461-69998483 ACGCCCACACAATGGGGCACTGG - Intergenic
1089662373 11:119993922-119993944 CTGCCCCCACAGGGGGGCAGTGG - Intergenic
1097158360 12:57028676-57028698 CCTCCCACACAGGAGGGCAGAGG + Exonic
1104936352 12:132366412-132366434 CCGCCCTGACAGCGGGACCCTGG - Intergenic
1113466428 13:110516693-110516715 CGCCCCACACAGCTGGGCACAGG - Intergenic
1113708568 13:112449384-112449406 CCGCCCACAGAGAGGGAGACTGG + Intergenic
1113743165 13:112724949-112724971 CAGCCCACACAGGGGACCACAGG - Intronic
1117445237 14:55797954-55797976 CCTCACACACAGCAGTGCACTGG + Intergenic
1118596730 14:67441420-67441442 CTGCCCACACAGTGGTTCACTGG - Intergenic
1118770195 14:68937832-68937854 CCGCCCACACAGCAGGGGGCTGG - Intronic
1119730952 14:76950782-76950804 CCCTCCACCCAGTGGGGCACTGG - Intergenic
1121908442 14:97768292-97768314 CAGCCCAAACTGTGGGGCACAGG + Intergenic
1122415294 14:101546797-101546819 CAGCCCACACAGCCGTGCACGGG + Intergenic
1122903725 14:104792504-104792526 CCTCCCACCCAGCAGGGCACAGG + Intronic
1123014450 14:105367141-105367163 CAGCCCACACATCAGGGCACCGG + Intronic
1127995512 15:64151536-64151558 GCGCCCACAGCGCGGGGCAGTGG - Intergenic
1129781516 15:78275171-78275193 CCGCCCACTTCCCGGGGCACAGG - Intronic
1130046967 15:80453122-80453144 TCACACACACAGCGTGGCACTGG + Intronic
1130959186 15:88648511-88648533 CCGCCAGCAAAGCGGGGCGCAGG - Intronic
1132629486 16:910309-910331 CCGCCCCCACACCAGGGCCCAGG + Intronic
1132670820 16:1101714-1101736 CGGCCCACACACCGGGGCACGGG - Intergenic
1132774243 16:1583112-1583134 ACGCCCACACAGCAGGCCCCAGG + Intronic
1133187417 16:4109962-4109984 CCGCCCCCACAGAGAAGCACAGG + Intronic
1136580481 16:31148476-31148498 CAGGCCACACGGCGGGGCCCAGG + Exonic
1138552233 16:57754195-57754217 TCCCCCACACACCAGGGCACAGG - Intronic
1138650341 16:58457033-58457055 CCACCCACAGAGCTGGGCATGGG - Intergenic
1142291953 16:89197258-89197280 CCGGCCACACAGCAGGGTCCAGG - Intronic
1142743194 17:1942311-1942333 CCCCCCACACCCCGGGGCTCAGG - Intronic
1147183761 17:38702925-38702947 CAGCCCAGCCCGCGGGGCACCGG + Intergenic
1152810238 17:82378404-82378426 CAGCCCAGACGGCGGGGCACAGG + Intergenic
1158622158 18:59042267-59042289 CCACACACACAGCGAGGCCCAGG + Intergenic
1158974945 18:62702951-62702973 CTGGCCCCACAGCGTGGCACAGG - Intergenic
1160799014 19:959035-959057 CCTCCCACACACCCAGGCACAGG - Intronic
1160844340 19:1159894-1159916 CCCCCCACAGAGCTGGGCAGTGG + Intronic
1161316866 19:3621296-3621318 CCGCCCACACAGCGGGGCACAGG + Intronic
1161611982 19:5248136-5248158 CGGCACCCACAGCGAGGCACAGG + Intronic
1161809531 19:6464163-6464185 CCGCCCTCTCAGCGAGGCTCAGG + Intronic
1162535634 19:11261846-11261868 CCCCCCCGACAGCTGGGCACTGG + Intronic
1162938678 19:13995165-13995187 CAGGCCACACAGCGGGGAAGTGG + Intronic
1163822856 19:19506068-19506090 CCGCCCACCCTCCAGGGCACAGG - Exonic
1165889393 19:39101377-39101399 GCGCCCACACAGCTGGGGTCAGG + Intronic
1166318075 19:41999670-41999692 CCGGGCACACAGCAGGCCACAGG - Intronic
1166387217 19:42389115-42389137 CCGCCCAGACTGCCCGGCACAGG - Intronic
1166664378 19:44669970-44669992 CAGCACACACAACTGGGCACTGG + Intronic
927965345 2:27264504-27264526 CCGCCCGCACACCTTGGCACGGG - Intronic
932435165 2:71699080-71699102 CTGGGCACACAGCGGGGCTCAGG + Intergenic
932878469 2:75477058-75477080 CCACCCACAGAGCTGGGGACTGG - Intronic
938536562 2:132253518-132253540 GCCCCCACAGAGCGGGGTACAGG + Intronic
946382435 2:219358343-219358365 CTGCCCACACAGCGCGCCGCAGG + Intergenic
947423362 2:229960528-229960550 TCGCCCACACAGCAGTGCACTGG + Intronic
948530073 2:238598602-238598624 CCCTGGACACAGCGGGGCACAGG - Intergenic
948877859 2:240839740-240839762 CCCCTCACAGTGCGGGGCACTGG - Intergenic
1169483476 20:6006355-6006377 CAGCCCAAGCAGCAGGGCACGGG - Exonic
1171865458 20:30485291-30485313 GCCCCCACAGCGCGGGGCACAGG + Intergenic
1173844258 20:46178083-46178105 CCGCCCACACTGAGCAGCACAGG - Exonic
1176233935 20:64045490-64045512 CAGCCCAAACAGGGAGGCACTGG + Intronic
1176443874 21:6801284-6801306 CAGCCCGCACTGCGGAGCACTGG + Intergenic
1178661439 21:34510683-34510705 CAGCCCACACAGCTGAACACAGG + Intergenic
1179707970 21:43193581-43193603 GCCCCCAGACAGAGGGGCACGGG - Intergenic
1179918870 21:44496309-44496331 ACTCCCACACTGCGGGGCAGGGG + Intergenic
1179938057 21:44617401-44617423 CCGCCCACCCAGCCCAGCACAGG - Intronic
1180230171 21:46422299-46422321 CCGCCCACCCAGCCCTGCACTGG + Intronic
1181021674 22:20106801-20106823 CAGCACACACAGCTGGGCTCAGG - Intronic
1184839468 22:47044037-47044059 CAGCCCAGGCAGCTGGGCACTGG + Intronic
1185044766 22:48523375-48523397 CCGGCCACACAGGAGGGCCCAGG - Intronic
1185106074 22:48870669-48870691 CGGCCCCCACAGGGGGGCCCAGG - Intergenic
949922015 3:9010362-9010384 CAGCCCACACAGCGAGCCAGGGG - Exonic
950677951 3:14565807-14565829 AAGCCCACACAGAGGGGCGCTGG + Intergenic
953890686 3:46749997-46750019 GAGCCCACACAGCAGGGCACAGG + Intronic
953917195 3:46927599-46927621 CCACCCCCAGAGCGGAGCACTGG + Intronic
961403327 3:126662451-126662473 CCGCCTCCACAGCATGGCACCGG + Intergenic
962793984 3:138834998-138835020 CCGCCGCCACCGCGGGGCCCGGG - Intergenic
963791042 3:149582688-149582710 CCGCCCACACTGGGGTGCAGTGG - Intronic
969284579 4:6194907-6194929 CAGACCACACAGAGGGGAACAGG + Intronic
969439173 4:7207340-7207362 CCGCCCACACAGCCTGGGCCGGG + Intronic
982325486 4:154125051-154125073 CAGGCCACACAGGGAGGCACTGG + Intergenic
984206224 4:176791846-176791868 CTGCCCAGTCAGCGGGGCTCTGG - Intronic
985784883 5:1888172-1888194 TCGCCCCCGCAGCCGGGCACAGG + Intergenic
985791759 5:1931806-1931828 CCGCCCACTCCGCAGGGCCCGGG + Intergenic
986093979 5:4537782-4537804 CCACCCACAAAGCGGGTCAGGGG + Intergenic
991398980 5:66234295-66234317 CCGCGCACACAGAGAGGCAGAGG - Intergenic
992086306 5:73281165-73281187 CCGCCCACAGAGGGTGGCAAGGG - Intergenic
997618539 5:135270164-135270186 CCCCCCACCCAGTGGGGCAGTGG + Intronic
1001685433 5:173591119-173591141 CCGCCCACACACCGGCACGCAGG + Intergenic
1002181988 5:177435426-177435448 CCTCCCTCACAGATGGGCACAGG - Intronic
1004985585 6:21078698-21078720 CCTCTCACACAGCGGGGTGCAGG + Intronic
1006124341 6:31827927-31827949 GAGCCCACAGAGCAGGGCACCGG + Exonic
1013836703 6:114342821-114342843 GCGCCCGCACAGCTTGGCACCGG - Exonic
1016690709 6:146934550-146934572 CCCCCCACACAGCTGGTCATGGG - Intergenic
1019466718 7:1193710-1193732 CGGCCCACACAGCTGGGGAGCGG - Intergenic
1019749356 7:2719066-2719088 CCACCCACCCAGAAGGGCACAGG - Intronic
1022484875 7:30770765-30770787 AGGCCCACACAGCTGGGTACTGG - Intronic
1026901460 7:74039672-74039694 CCGCCCACTGAGAGGGGCACGGG + Intronic
1035238428 7:157515108-157515130 CTGCCCAGACAGCAGGGCAGGGG + Intergenic
1035350750 7:158244918-158244940 CGGCCCCCACCCCGGGGCACTGG - Intronic
1035571821 8:677396-677418 CCACCACCACAGCGTGGCACAGG + Intronic
1038492140 8:27979041-27979063 CCACCCACACAGTCGAGCACAGG + Intronic
1038515057 8:28180943-28180965 CCTCCTAAACAGCAGGGCACTGG + Intronic
1045098981 8:98825979-98826001 CCGCCCACCCGCCGCGGCACCGG - Intronic
1045338406 8:101230166-101230188 CCACCCACTGGGCGGGGCACAGG + Intergenic
1049345988 8:142138901-142138923 CCGTCCACACAGAGGGAGACGGG + Intergenic
1049769654 8:144373975-144373997 CCGCCCACGGGGCGGGGCTCTGG + Intronic
1052747546 9:32455040-32455062 CCTCCCACATAGCTGGGTACAGG - Intergenic
1053129200 9:35605632-35605654 CGGCCCCCACTGCGGGGCCCTGG + Exonic
1056824671 9:89868598-89868620 GCACCCACACAGCGCTGCACTGG - Intergenic
1062043576 9:134415146-134415168 CCGCCCACACAGGGAGACTCAGG - Intronic
1062076100 9:134590772-134590794 CCGCCCACAGAGAGAGGCCCTGG + Intergenic
1062088260 9:134659808-134659830 GTGCACACACAGCTGGGCACAGG - Intronic
1203525326 Un_GL000213v1:83243-83265 CAGCCCGCACTGCGGAGCACTGG - Intergenic
1196625055 X:117868891-117868913 CCTCCCACACAGCAGTGCCCAGG - Intergenic
1198239355 X:134768016-134768038 CCCCCCACACAGAGAGACACAGG + Intergenic