ID: 1161319568

View in Genome Browser
Species Human (GRCh38)
Location 19:3634671-3634693
Sequence AGCACAAGGGAGGCCCCTGC TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total
Summary

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1161319568_1161319579 28 Left 1161319568 19:3634671-3634693 CCAGCAGGGGCCTCCCTTGTGCT No data
Right 1161319579 19:3634722-3634744 AGCACTGCCTCTCCCTGCCTCGG No data
1161319568_1161319580 29 Left 1161319568 19:3634671-3634693 CCAGCAGGGGCCTCCCTTGTGCT No data
Right 1161319580 19:3634723-3634745 GCACTGCCTCTCCCTGCCTCGGG No data
1161319568_1161319574 5 Left 1161319568 19:3634671-3634693 CCAGCAGGGGCCTCCCTTGTGCT No data
Right 1161319574 19:3634699-3634721 TGAGCCCAGACCTCACCTGCAGG 0: 1
1: 0
2: 4
3: 27
4: 234

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1161319568 Original CRISPR AGCACAAGGGAGGCCCCTGC TGG (reversed) Intronic