ID: 1161319571

View in Genome Browser
Species Human (GRCh38)
Location 19:3634684-3634706
Sequence TGGGCTCACCTGGAGCACAA GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total
Summary

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1161319571_1161319579 15 Left 1161319571 19:3634684-3634706 CCCTTGTGCTCCAGGTGAGCCCA No data
Right 1161319579 19:3634722-3634744 AGCACTGCCTCTCCCTGCCTCGG No data
1161319571_1161319574 -8 Left 1161319571 19:3634684-3634706 CCCTTGTGCTCCAGGTGAGCCCA No data
Right 1161319574 19:3634699-3634721 TGAGCCCAGACCTCACCTGCAGG 0: 1
1: 0
2: 4
3: 27
4: 234
1161319571_1161319580 16 Left 1161319571 19:3634684-3634706 CCCTTGTGCTCCAGGTGAGCCCA No data
Right 1161319580 19:3634723-3634745 GCACTGCCTCTCCCTGCCTCGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1161319571 Original CRISPR TGGGCTCACCTGGAGCACAA GGG (reversed) Intronic