ID: 1161319572

View in Genome Browser
Species Human (GRCh38)
Location 19:3634685-3634707
Sequence CTGGGCTCACCTGGAGCACA AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total
Summary

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1161319572_1161319579 14 Left 1161319572 19:3634685-3634707 CCTTGTGCTCCAGGTGAGCCCAG No data
Right 1161319579 19:3634722-3634744 AGCACTGCCTCTCCCTGCCTCGG No data
1161319572_1161319580 15 Left 1161319572 19:3634685-3634707 CCTTGTGCTCCAGGTGAGCCCAG No data
Right 1161319580 19:3634723-3634745 GCACTGCCTCTCCCTGCCTCGGG No data
1161319572_1161319574 -9 Left 1161319572 19:3634685-3634707 CCTTGTGCTCCAGGTGAGCCCAG No data
Right 1161319574 19:3634699-3634721 TGAGCCCAGACCTCACCTGCAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1161319572 Original CRISPR CTGGGCTCACCTGGAGCACA AGG (reversed) Intronic