ID: 1161319573

View in Genome Browser
Species Human (GRCh38)
Location 19:3634694-3634716
Sequence AGGTGAGGTCTGGGCTCACC TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total
Summary

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1161319573_1161319579 5 Left 1161319573 19:3634694-3634716 CCAGGTGAGCCCAGACCTCACCT No data
Right 1161319579 19:3634722-3634744 AGCACTGCCTCTCCCTGCCTCGG No data
1161319573_1161319580 6 Left 1161319573 19:3634694-3634716 CCAGGTGAGCCCAGACCTCACCT No data
Right 1161319580 19:3634723-3634745 GCACTGCCTCTCCCTGCCTCGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1161319573 Original CRISPR AGGTGAGGTCTGGGCTCACC TGG (reversed) Intronic