ID: 1161319574

View in Genome Browser
Species Human (GRCh38)
Location 19:3634699-3634721
Sequence TGAGCCCAGACCTCACCTGC AGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 266
Summary {0: 1, 1: 0, 2: 4, 3: 27, 4: 234}

Found 10 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1161319570_1161319574 -5 Left 1161319570 19:3634681-3634703 CCTCCCTTGTGCTCCAGGTGAGC No data
Right 1161319574 19:3634699-3634721 TGAGCCCAGACCTCACCTGCAGG 0: 1
1: 0
2: 4
3: 27
4: 234
1161319565_1161319574 16 Left 1161319565 19:3634660-3634682 CCCAGCCTGGGCCAGCAGGGGCC No data
Right 1161319574 19:3634699-3634721 TGAGCCCAGACCTCACCTGCAGG 0: 1
1: 0
2: 4
3: 27
4: 234
1161319557_1161319574 30 Left 1161319557 19:3634646-3634668 CCAGCTCCCAGTTGCCCAGCCTG No data
Right 1161319574 19:3634699-3634721 TGAGCCCAGACCTCACCTGCAGG 0: 1
1: 0
2: 4
3: 27
4: 234
1161319572_1161319574 -9 Left 1161319572 19:3634685-3634707 CCTTGTGCTCCAGGTGAGCCCAG No data
Right 1161319574 19:3634699-3634721 TGAGCCCAGACCTCACCTGCAGG 0: 1
1: 0
2: 4
3: 27
4: 234
1161319560_1161319574 24 Left 1161319560 19:3634652-3634674 CCCAGTTGCCCAGCCTGGGCCAG No data
Right 1161319574 19:3634699-3634721 TGAGCCCAGACCTCACCTGCAGG 0: 1
1: 0
2: 4
3: 27
4: 234
1161319571_1161319574 -8 Left 1161319571 19:3634684-3634706 CCCTTGTGCTCCAGGTGAGCCCA No data
Right 1161319574 19:3634699-3634721 TGAGCCCAGACCTCACCTGCAGG 0: 1
1: 0
2: 4
3: 27
4: 234
1161319566_1161319574 15 Left 1161319566 19:3634661-3634683 CCAGCCTGGGCCAGCAGGGGCCT No data
Right 1161319574 19:3634699-3634721 TGAGCCCAGACCTCACCTGCAGG 0: 1
1: 0
2: 4
3: 27
4: 234
1161319568_1161319574 5 Left 1161319568 19:3634671-3634693 CCAGCAGGGGCCTCCCTTGTGCT No data
Right 1161319574 19:3634699-3634721 TGAGCCCAGACCTCACCTGCAGG 0: 1
1: 0
2: 4
3: 27
4: 234
1161319561_1161319574 23 Left 1161319561 19:3634653-3634675 CCAGTTGCCCAGCCTGGGCCAGC No data
Right 1161319574 19:3634699-3634721 TGAGCCCAGACCTCACCTGCAGG 0: 1
1: 0
2: 4
3: 27
4: 234
1161319567_1161319574 11 Left 1161319567 19:3634665-3634687 CCTGGGCCAGCAGGGGCCTCCCT No data
Right 1161319574 19:3634699-3634721 TGAGCCCAGACCTCACCTGCAGG 0: 1
1: 0
2: 4
3: 27
4: 234

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1161319574 Original CRISPR TGAGCCCAGACCTCACCTGC AGG Intronic