ID: 1161319577

View in Genome Browser
Species Human (GRCh38)
Location 19:3634709-3634731
Sequence AGGCAGTGCTCCTGCAGGTG AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total
Summary

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1161319577_1161319579 -10 Left 1161319577 19:3634709-3634731 CCTCACCTGCAGGAGCACTGCCT No data
Right 1161319579 19:3634722-3634744 AGCACTGCCTCTCCCTGCCTCGG No data
1161319577_1161319580 -9 Left 1161319577 19:3634709-3634731 CCTCACCTGCAGGAGCACTGCCT No data
Right 1161319580 19:3634723-3634745 GCACTGCCTCTCCCTGCCTCGGG No data
1161319577_1161319586 18 Left 1161319577 19:3634709-3634731 CCTCACCTGCAGGAGCACTGCCT No data
Right 1161319586 19:3634750-3634772 GCCTCCATGCTCCCTCTAAAGGG No data
1161319577_1161319585 17 Left 1161319577 19:3634709-3634731 CCTCACCTGCAGGAGCACTGCCT No data
Right 1161319585 19:3634749-3634771 TGCCTCCATGCTCCCTCTAAAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1161319577 Original CRISPR AGGCAGTGCTCCTGCAGGTG AGG (reversed) Intronic