ID: 1161319580

View in Genome Browser
Species Human (GRCh38)
Location 19:3634723-3634745
Sequence GCACTGCCTCTCCCTGCCTC GGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total
Summary

Found 8 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1161319575_1161319580 -3 Left 1161319575 19:3634703-3634725 CCCAGACCTCACCTGCAGGAGCA No data
Right 1161319580 19:3634723-3634745 GCACTGCCTCTCCCTGCCTCGGG No data
1161319576_1161319580 -4 Left 1161319576 19:3634704-3634726 CCAGACCTCACCTGCAGGAGCAC No data
Right 1161319580 19:3634723-3634745 GCACTGCCTCTCCCTGCCTCGGG No data
1161319577_1161319580 -9 Left 1161319577 19:3634709-3634731 CCTCACCTGCAGGAGCACTGCCT No data
Right 1161319580 19:3634723-3634745 GCACTGCCTCTCCCTGCCTCGGG No data
1161319570_1161319580 19 Left 1161319570 19:3634681-3634703 CCTCCCTTGTGCTCCAGGTGAGC No data
Right 1161319580 19:3634723-3634745 GCACTGCCTCTCCCTGCCTCGGG No data
1161319572_1161319580 15 Left 1161319572 19:3634685-3634707 CCTTGTGCTCCAGGTGAGCCCAG No data
Right 1161319580 19:3634723-3634745 GCACTGCCTCTCCCTGCCTCGGG No data
1161319568_1161319580 29 Left 1161319568 19:3634671-3634693 CCAGCAGGGGCCTCCCTTGTGCT No data
Right 1161319580 19:3634723-3634745 GCACTGCCTCTCCCTGCCTCGGG No data
1161319573_1161319580 6 Left 1161319573 19:3634694-3634716 CCAGGTGAGCCCAGACCTCACCT No data
Right 1161319580 19:3634723-3634745 GCACTGCCTCTCCCTGCCTCGGG No data
1161319571_1161319580 16 Left 1161319571 19:3634684-3634706 CCCTTGTGCTCCAGGTGAGCCCA No data
Right 1161319580 19:3634723-3634745 GCACTGCCTCTCCCTGCCTCGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1161319580 Original CRISPR GCACTGCCTCTCCCTGCCTC GGG Intronic