ID: 1161320032

View in Genome Browser
Species Human (GRCh38)
Location 19:3636895-3636917
Sequence CACGTAGCTGTGAGATCCTC AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 91
Summary {0: 1, 1: 0, 2: 0, 3: 7, 4: 83}

Found 8 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1161320032_1161320037 -2 Left 1161320032 19:3636895-3636917 CCTGAGGATCTCACAGCTACGTG 0: 1
1: 0
2: 0
3: 7
4: 83
Right 1161320037 19:3636916-3636938 TGGGGCCCATGTGGCGTCCCAGG 0: 1
1: 0
2: 1
3: 11
4: 133
1161320032_1161320040 1 Left 1161320032 19:3636895-3636917 CCTGAGGATCTCACAGCTACGTG 0: 1
1: 0
2: 0
3: 7
4: 83
Right 1161320040 19:3636919-3636941 GGCCCATGTGGCGTCCCAGGGGG 0: 1
1: 0
2: 1
3: 18
4: 172
1161320032_1161320038 -1 Left 1161320032 19:3636895-3636917 CCTGAGGATCTCACAGCTACGTG 0: 1
1: 0
2: 0
3: 7
4: 83
Right 1161320038 19:3636917-3636939 GGGGCCCATGTGGCGTCCCAGGG 0: 1
1: 0
2: 1
3: 11
4: 109
1161320032_1161320046 20 Left 1161320032 19:3636895-3636917 CCTGAGGATCTCACAGCTACGTG 0: 1
1: 0
2: 0
3: 7
4: 83
Right 1161320046 19:3636938-3636960 GGGGACCTCCTTGAGAGCTTGGG 0: 1
1: 0
2: 2
3: 10
4: 126
1161320032_1161320039 0 Left 1161320032 19:3636895-3636917 CCTGAGGATCTCACAGCTACGTG 0: 1
1: 0
2: 0
3: 7
4: 83
Right 1161320039 19:3636918-3636940 GGGCCCATGTGGCGTCCCAGGGG 0: 1
1: 0
2: 2
3: 13
4: 115
1161320032_1161320045 19 Left 1161320032 19:3636895-3636917 CCTGAGGATCTCACAGCTACGTG 0: 1
1: 0
2: 0
3: 7
4: 83
Right 1161320045 19:3636937-3636959 GGGGGACCTCCTTGAGAGCTTGG 0: 1
1: 0
2: 1
3: 14
4: 137
1161320032_1161320047 21 Left 1161320032 19:3636895-3636917 CCTGAGGATCTCACAGCTACGTG 0: 1
1: 0
2: 0
3: 7
4: 83
Right 1161320047 19:3636939-3636961 GGGACCTCCTTGAGAGCTTGGGG 0: 1
1: 0
2: 1
3: 16
4: 127
1161320032_1161320049 27 Left 1161320032 19:3636895-3636917 CCTGAGGATCTCACAGCTACGTG 0: 1
1: 0
2: 0
3: 7
4: 83
Right 1161320049 19:3636945-3636967 TCCTTGAGAGCTTGGGGATCTGG 0: 1
1: 0
2: 0
3: 17
4: 134

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1161320032 Original CRISPR CACGTAGCTGTGAGATCCTC AGG (reversed) Intronic
908455078 1:64296148-64296170 CATGTGGCTTTGAGCTCCTCAGG - Intergenic
911264860 1:95731142-95731164 GAGGTAGCTGTGATAGCCTCAGG + Intergenic
915019243 1:152763852-152763874 TCTGTAGCTGTGAGGTCCTCTGG - Intronic
915891146 1:159774962-159774984 CCCCGACCTGTGAGATCCTCAGG - Intergenic
920714864 1:208330417-208330439 CACTCAGCTCTGAGAGCCTCAGG + Intergenic
920822641 1:209395739-209395761 CACGTAGATGACATATCCTCAGG - Intergenic
1063071614 10:2671937-2671959 CAGCTTGCTGTGAGAGCCTCAGG + Intergenic
1065522275 10:26584453-26584475 CTCGTAGATGTGAGAGCCACAGG - Intergenic
1068008838 10:51422326-51422348 CACCTAGCTGTGGCATCCTATGG - Intronic
1070932828 10:80273111-80273133 CACGTGGCTGTGGGACCCTGTGG + Exonic
1071679872 10:87694395-87694417 CCTGTAGCTATGAGATCCTGTGG - Intronic
1071978457 10:90978707-90978729 CACGTGCCTGTGACAGCCTCAGG - Intergenic
1076758245 10:132586387-132586409 CACGGAGCTGTGAGCCCCTAGGG - Intronic
1077314003 11:1908021-1908043 CTCGTAGCTGTGTGACCTTCAGG + Intergenic
1079743409 11:24093670-24093692 CACATGGCAGGGAGATCCTCAGG + Intergenic
1083173345 11:60935387-60935409 CACGTAGCTGTGACCTCCCCGGG - Exonic
1091232179 11:133995782-133995804 CACATAGGAGTGAGATCCTGCGG - Intergenic
1091604046 12:1935437-1935459 CACTGGTCTGTGAGATCCTCGGG + Intergenic
1092972031 12:13705273-13705295 CAAGTAACTGTGAGATCATATGG - Intronic
1098719987 12:73884138-73884160 CACATGGCTGTGGGAGCCTCAGG - Intergenic
1099255874 12:80310801-80310823 CACGTAACTGGGTGATCCACTGG + Intronic
1101948625 12:109157171-109157193 CACCAAGCTGTGTGATCTTCTGG + Intronic
1112898903 13:104335831-104335853 AACTTGGCTGTGAGGTCCTCAGG + Intergenic
1113104651 13:106759226-106759248 CACTTAGCTGAGAGATCCCGTGG + Intergenic
1120421946 14:84298628-84298650 CACTTGACTGTGAGATCCTTGGG - Intergenic
1120915304 14:89705127-89705149 CACATAACTGTGAGATCCACTGG - Intergenic
1122160808 14:99782438-99782460 CTCTGAGCTGTGAGACCCTCGGG + Intronic
1122415133 14:101545826-101545848 CACGTAACTGTGGGATGCTGGGG - Intergenic
1126430104 15:48574039-48574061 CATGAAGCTGTGTGATACTCAGG + Intronic
1129782102 15:78279433-78279455 CACGTAGCTGTAAGACCCAGCGG + Intronic
1132668240 16:1091470-1091492 CACGTGGCTGGGAGAGCTTCCGG + Intronic
1136630241 16:31485662-31485684 CACGAAGAGGTCAGATCCTCAGG + Intronic
1147154069 17:38534395-38534417 CACTTACCTTTGAGATCCACTGG + Intronic
1150213595 17:63454908-63454930 CAAGTGGCTGTGAGAGCCTGGGG - Intergenic
1150354261 17:64469755-64469777 CACGCTGCTGTGGGCTCCTCTGG + Intergenic
1158592620 18:58790308-58790330 CTCGGAGCTGGGAGACCCTCAGG + Intergenic
1160776603 19:859483-859505 CAAGTCGCTGGGAGACCCTCGGG - Intergenic
1161085396 19:2332821-2332843 CCCATCGCTGTGAGACCCTCTGG + Intronic
1161320032 19:3636895-3636917 CACGTAGCTGTGAGATCCTCAGG - Intronic
1161782954 19:6305843-6305865 CACGGACTTGTGAGGTCCTCAGG - Intergenic
1162711331 19:12597035-12597057 CACGCTGCTGGGAGACCCTCGGG + Intronic
1166038884 19:40190848-40190870 GACGTGGCTGTGACATCCCCAGG + Intergenic
925171487 2:1752563-1752585 CACCTAACTGTGAGTTTCTCAGG - Intergenic
926767569 2:16335705-16335727 CAGTTTGCTGTGGGATCCTCAGG - Intergenic
928368643 2:30722798-30722820 CATTTAGCTGTGAAATCATCAGG + Exonic
933342798 2:81043905-81043927 CACCTAGCTGTGAAATCAGCAGG - Intergenic
939212599 2:139196005-139196027 CAAGTAGCTGTGATTTGCTCAGG - Intergenic
1172219725 20:33265267-33265289 CACATGGTTGTGAGATCCACTGG + Intergenic
1172756014 20:37284978-37285000 CACCGAGCTGTGAGAAGCTCAGG - Intergenic
1174158361 20:48532188-48532210 GAGGTGGCTGTGACATCCTCAGG - Intergenic
1179449711 21:41460178-41460200 CACCAAGGTGTGACATCCTCTGG + Intergenic
954801633 3:53190363-53190385 CAACTAGCTGAGAGCTCCTCCGG - Intronic
956312259 3:67894308-67894330 CACTTACCTGTGAGCTCCTTAGG + Intergenic
958598397 3:96260496-96260518 CATGTAGCTCTGATTTCCTCTGG + Intergenic
960120758 3:113947558-113947580 CACGTAGTTCGGAAATCCTCCGG + Intergenic
967816450 3:193803014-193803036 GAGGTAGCTGTGCGATCATCTGG - Intergenic
969099195 4:4756286-4756308 CACATTCCTGTGAGATACTCAGG + Intergenic
971867303 4:32189647-32189669 CACATGGCTGTGGGAGCCTCAGG + Intergenic
973805726 4:54524449-54524471 CACGTAGCTGTAAGGTTCTTAGG + Intergenic
974183533 4:58415034-58415056 CACGTAGCTGTGGTGGCCTCAGG - Intergenic
976913653 4:90342254-90342276 CACAAAACTGTGAGATCCCCAGG - Intronic
978228199 4:106364413-106364435 CAAGAAGCTGTTAGGTCCTCAGG - Intergenic
984650112 4:182262152-182262174 CATGTAGCTATGAGATGATCAGG - Intronic
988316660 5:29639928-29639950 CACGTATCAGTGAGATCATGAGG - Intergenic
991504379 5:67308822-67308844 CAGGTAGGTGTGGGAACCTCAGG - Intergenic
996826373 5:127686259-127686281 TAAGTTGCTGTGAGATTCTCTGG + Intergenic
999032740 5:148312332-148312354 CACCGTGCTTTGAGATCCTCTGG + Intergenic
1000016682 5:157283935-157283957 CAGGGAGTTGTGAGATCCTGGGG - Intronic
1004022124 6:11785600-11785622 CACTTGGCAGTGAGTTCCTCCGG - Intronic
1006607207 6:35266700-35266722 CAGGTAGCTATGTGATCCTTTGG + Intronic
1010079722 6:71846339-71846361 GAGGTAGCTGTGAGCTCCTCGGG - Intergenic
1011657253 6:89563215-89563237 CAAGCAGCTGTGTGACCCTCTGG + Intronic
1032476383 7:132214178-132214200 CTCGGAGCTGTGAAACCCTCCGG + Intronic
1034757475 7:153635964-153635986 CACGTATAAGTGAGATCATCTGG + Intergenic
1037656853 8:20891430-20891452 GAGGCAGCTGTGAGATCTTCTGG - Intergenic
1040676329 8:49755473-49755495 CACTTACCTGTGAGAACCTCTGG + Intergenic
1042668974 8:71239730-71239752 CAAGCACCTGTGAGATCCTTTGG + Intronic
1042782745 8:72509993-72510015 CCCGTTGCTGTGAAAACCTCTGG - Intergenic
1043203057 8:77396475-77396497 CATGCAGCTGTGAGCGCCTCTGG + Intergenic
1044569733 8:93703708-93703730 CACTTAACTGTGAGTTACTCTGG + Intronic
1044874549 8:96652195-96652217 CACGTAGAAGTGAGATCATGTGG + Intronic
1046723906 8:117654007-117654029 CACCTAGCTGTGTGGCCCTCAGG - Intergenic
1048150416 8:131888228-131888250 CACCTGCCTGTAAGATCCTCTGG - Intergenic
1049017502 8:139931128-139931150 CCGCAAGCTGTGAGATCCTCGGG + Intronic
1049199917 8:141334961-141334983 GACGCAGCTCTGACATCCTCAGG + Intergenic
1049353297 8:142175607-142175629 CAGCTGGCTGTGAGATCCTGGGG - Intergenic
1055019670 9:71656275-71656297 CACGTATCTGTGACAGCCTCAGG - Intergenic
1056241241 9:84648706-84648728 CACGTACAAGTGAGATCCTATGG + Intergenic
1060729840 9:126030263-126030285 CACGCAGCTGTGCGATGCTCAGG + Intergenic
1190970263 X:55341762-55341784 CACAGGGCTCTGAGATCCTCAGG - Intergenic
1192322902 X:70106432-70106454 CACCTAGCTGTTAGAGCCTCAGG + Intergenic