ID: 1161320253

View in Genome Browser
Species Human (GRCh38)
Location 19:3637739-3637761
Sequence ACTGCCAAGCAGAAGGTGGG GGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 345
Summary {0: 1, 1: 0, 2: 3, 3: 26, 4: 315}

Found 0 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1161320253 Original CRISPR ACTGCCAAGCAGAAGGTGGG GGG Intronic
900572423 1:3365163-3365185 ACTGCCAAGCTCCAGGCGGGGGG - Intronic
900948410 1:5844131-5844153 GCTGCCAGGCAGGAGGTGAGGGG - Intergenic
903730223 1:25488292-25488314 ACTCCCAAGGCCAAGGTGGGAGG - Intronic
904480234 1:30788736-30788758 TCTGCCAGGCAGGTGGTGGGAGG + Intergenic
904851531 1:33463213-33463235 AGGGCCAAGCAGAAGGCAGGTGG - Intergenic
905249281 1:36637756-36637778 ACTTCCAAGCAGGAGGAGTGGGG + Intergenic
905640782 1:39588392-39588414 ACTGCCAAGGAGCAGGGTGGGGG - Intergenic
905688921 1:39928437-39928459 GCTGCACAGCAGAAGGTGAGTGG + Intergenic
906567947 1:46813890-46813912 CCTGCTAAGCAGAGGGTAGGAGG - Exonic
907276760 1:53321137-53321159 ACTGCCCAGCACAAGGCTGGCGG + Intronic
907552197 1:55313932-55313954 ACTGGCTAGCAAAAGGAGGGAGG - Intergenic
909665141 1:78123664-78123686 ACTGGCAAACAGAATGTGGATGG + Intronic
910493041 1:87794413-87794435 ACTACCAAGCTGAAGTAGGGAGG - Intergenic
910676209 1:89819689-89819711 ACTGCCAAGAAGGAGGTGTATGG - Intronic
915074331 1:153296398-153296420 AACTCCAAGCAGGAGGTGGGTGG - Intergenic
915326323 1:155082817-155082839 ACTGCTAGGGAGAAGGAGGGAGG + Intronic
915438256 1:155925764-155925786 AATGTCAAGGAGAAGGTGGAAGG - Exonic
915839542 1:159203386-159203408 AATGCCTGGCAGAGGGTGGGGGG - Intronic
916593713 1:166221013-166221035 ACTTGAAGGCAGAAGGTGGGAGG - Intergenic
918611363 1:186496123-186496145 ACTGGCAAGGAGAAGGTGAAAGG + Intergenic
919867571 1:201793861-201793883 ACGGCCGAGGAGAAGGTGAGAGG + Exonic
919879216 1:201891251-201891273 TCTGCCAAGCAGGGTGTGGGAGG + Intronic
920376335 1:205510344-205510366 ACTGCCTGGAAGCAGGTGGGCGG + Intronic
920851511 1:209631234-209631256 AATGCCAAGCTGAAGGTGTTGGG - Intronic
921799964 1:219391341-219391363 ACAGCCAAGCAAAAGGTTGTGGG + Intergenic
922085004 1:222338133-222338155 ACTGCACAGCAGGAGGTGAGCGG - Intergenic
923446126 1:234072938-234072960 ATGGCAAAGCAGATGGTGGGAGG + Intronic
923499197 1:234550559-234550581 ACAGCCAGGCAGGAGGAGGGCGG + Intergenic
1064145589 10:12823870-12823892 GTTGCCAAGCAGAATGTGGCAGG + Intronic
1065060664 10:21897504-21897526 ACCGCCTAGCAGGAGGTGAGCGG + Intronic
1065971847 10:30812012-30812034 ACCGGGGAGCAGAAGGTGGGGGG - Intergenic
1066050862 10:31633443-31633465 ACTGCTGAGGAGCAGGTGGGTGG + Intergenic
1069877039 10:71569237-71569259 ACAGCCAATGAGAGGGTGGGAGG - Intronic
1070715354 10:78716941-78716963 AGTGCCCAGCAGAAGGGGAGTGG - Intergenic
1073741507 10:106412954-106412976 ACTGCACAGCAGGAGGTGAGTGG + Intergenic
1074162194 10:110844421-110844443 GCTGTCAATCACAAGGTGGGGGG + Intergenic
1075242317 10:120790407-120790429 ACTGCAAAGCAGCAGGAGTGGGG - Intergenic
1075396061 10:122128035-122128057 ACTGCAAGGCAGAAGGTGGCAGG + Intronic
1076091087 10:127686281-127686303 CTTGGAAAGCAGAAGGTGGGTGG + Intergenic
1077317755 11:1926959-1926981 GCTGCCAACAGGAAGGTGGGAGG + Intronic
1078146745 11:8726887-8726909 ACTGCCAAGGTGGAGCTGGGAGG + Intronic
1079187032 11:18247046-18247068 ACTGCCAGTCAGCAGGTGGCAGG - Intronic
1079189771 11:18267853-18267875 ACTGCCAGTCAGCAGGTGGCAGG + Intronic
1079399123 11:20091561-20091583 ACTCCATGGCAGAAGGTGGGAGG - Intronic
1080971252 11:37279852-37279874 CCTGCCAGCCAGAAGGTGGATGG - Intergenic
1082740833 11:56909210-56909232 GCTGCATAGCAGAAGGTGAGTGG - Intergenic
1084266304 11:68007120-68007142 ACTGCCAGGGAGGGGGTGGGAGG + Intergenic
1084984173 11:72852985-72853007 ACTTGAAGGCAGAAGGTGGGAGG + Intronic
1087454880 11:98372353-98372375 GCTGCACAGCAGAAGGTGAGGGG - Intergenic
1087781468 11:102305296-102305318 ACTACCAACCAGAAGCAGGGAGG - Intergenic
1088648404 11:111936804-111936826 ACGGCCCACCAGAAGGTGGGTGG - Intronic
1088769057 11:113014958-113014980 ACACCCAAGCAGACGGTGGCTGG - Intronic
1090259568 11:125308876-125308898 ACTACCATGCAGAAGATGGTTGG - Intronic
1090422694 11:126586479-126586501 AATGACAAGCAGAAAGAGGGCGG - Intronic
1091460573 12:641317-641339 TCTGCAAAGCAGGAGGTGGAGGG - Intronic
1092526119 12:9311276-9311298 GCTGCCAGGAAGAAGGTGAGTGG + Intergenic
1092541161 12:9420507-9420529 GCTGCCAGGAAGAAGGTGAGTGG - Intergenic
1092622820 12:10291794-10291816 GCAGCCTATCAGAAGGTGGGGGG - Intergenic
1092957253 12:13562229-13562251 TGTGCCAAGCAGAGGTTGGGAGG - Exonic
1093071812 12:14713786-14713808 ACTGCCATGCAGAAGGCATGTGG + Intergenic
1093140892 12:15509271-15509293 ACAACCAAGCAGAGGGTTGGAGG + Intronic
1093245906 12:16736281-16736303 ACTGCAGAGCAGTAGGTGAGTGG + Intergenic
1093824202 12:23662329-23662351 AATGCCAAACAGAATCTGGGAGG + Intronic
1094511882 12:31101968-31101990 GCTGCCAGGAAGAAGGTGAGTGG + Exonic
1095357404 12:41292006-41292028 ACTGCCAAACACAACCTGGGTGG - Intronic
1095862088 12:46928733-46928755 GCTGCACAGCAGAAGGTGAGTGG - Intergenic
1098659552 12:73075261-73075283 ACTGCCAAGAACAATATGGGTGG - Intergenic
1100406039 12:94273598-94273620 AATGCCAGGTAGAATGTGGGAGG - Intronic
1102114990 12:110396138-110396160 GCTGCACAGCAGGAGGTGGGTGG - Intronic
1102542899 12:113635139-113635161 TCTTCCAAGCAGAGAGTGGGGGG - Intergenic
1102904929 12:116667187-116667209 ACTGACAAGCTGAAGGTAGAAGG + Intergenic
1103728882 12:123013039-123013061 ACTGCCAAGCAGGAGGAAGCTGG + Intronic
1103859241 12:123998781-123998803 ACTGCCCAACAGATGCTGGGTGG + Intronic
1104455789 12:128911233-128911255 GCATCCAGGCAGAAGGTGGGTGG - Intronic
1104550303 12:129750661-129750683 ACTCCCTACCAGAGGGTGGGAGG + Intronic
1104700797 12:130902786-130902808 ACTGCCACGGGGGAGGTGGGCGG - Intergenic
1105328385 13:19391151-19391173 GCTGCACAACAGAAGGTGGGGGG + Intergenic
1107508248 13:41057263-41057285 ACTTGCAAGCCTAAGGTGGGAGG - Intronic
1107974582 13:45677096-45677118 TCTGCCTAGCTCAAGGTGGGTGG + Intergenic
1108161322 13:47642998-47643020 ACTGCCAAGGGGAAGTAGGGTGG - Intergenic
1108481922 13:50881317-50881339 ACTGCACAGCAGGAGGTGAGTGG + Intergenic
1112022490 13:95383779-95383801 GCTGCACAGCAGGAGGTGGGTGG + Intergenic
1112240430 13:97676289-97676311 AGTGCCAGGTAGAAGGTGGATGG - Intergenic
1112887813 13:104195010-104195032 ACTGCACAGCAGGAGGTGAGTGG - Intergenic
1114150319 14:20031272-20031294 AATGGCAGGCAGAAGGAGGGCGG + Intergenic
1114840894 14:26260916-26260938 ACTTCCAAGATGATGGTGGGCGG - Intergenic
1115541620 14:34426600-34426622 TCTGCCAAGAACAAGGTGTGGGG + Intronic
1115585369 14:34806444-34806466 TCAGCCTATCAGAAGGTGGGAGG - Intronic
1116264299 14:42666879-42666901 GCTGCCAAGCAGGAGGTGAGTGG + Intergenic
1116925558 14:50631866-50631888 ACTGCCAATCAGAAGTTATGAGG + Intronic
1119121598 14:72084329-72084351 GCTGCATAGCAGGAGGTGGGCGG - Intronic
1120051587 14:79873348-79873370 TCTGGCAAGCAGGATGTGGGAGG - Intergenic
1121109957 14:91305757-91305779 ACCGCCAAGCTGCAGGTGAGCGG - Exonic
1121969665 14:98344587-98344609 AATGCCAAGCAAAAGGGGAGGGG + Intergenic
1121991245 14:98559788-98559810 TCTGCCATACAGAAAGTGGGGGG - Intergenic
1122355344 14:101119869-101119891 ACAGGAAAGCAGGAGGTGGGGGG - Intergenic
1123679159 15:22745247-22745269 GCTGCACAGCAGGAGGTGGGTGG + Intergenic
1124331378 15:28819697-28819719 GCTGCACAGCAGGAGGTGGGTGG + Intergenic
1124403114 15:29367669-29367691 ACTGCCTTGCAGAATGTGGAAGG + Intronic
1125546182 15:40507323-40507345 ACTGGGAAGCAGCAGGCGGGCGG - Intergenic
1125764467 15:42124029-42124051 ATTGCCAAGCGTTAGGTGGGAGG - Intergenic
1126796119 15:52261599-52261621 GCTGCCAGGCAGAAGCTGGTGGG + Intronic
1126927392 15:53605335-53605357 ACTGAAGAACAGAAGGTGGGAGG + Intronic
1129080352 15:73033842-73033864 ACTTCCTAGCATAAGGTGGAAGG + Intergenic
1129254902 15:74328738-74328760 CCTGCCATGCAGCAGGTGGGAGG + Intronic
1131694344 15:94859095-94859117 ACTGCCAGGTAGAGGGTGGAGGG - Intergenic
1133439102 16:5805808-5805830 ACAGGGTAGCAGAAGGTGGGAGG - Intergenic
1133694635 16:8250224-8250246 TCTGCAATGCAGAAGGTGGAGGG + Intergenic
1136126322 16:28184269-28184291 AATCCCAAGCACAAGGTAGGAGG - Intronic
1137596789 16:49729139-49729161 ACAGCTTAGCAGAAGGTGTGGGG + Intronic
1139323346 16:66133121-66133143 ACTGCCAAGGCCAAGGTTGGGGG - Intergenic
1139392550 16:66614175-66614197 GCTGCACAGCAGGAGGTGGGTGG - Intergenic
1140375380 16:74441344-74441366 ACTGTCAAGAAGAAGGAGGAAGG - Intergenic
1140802163 16:78498484-78498506 ACTGAGAAGCACAAGGTGTGAGG + Intronic
1140977446 16:80073671-80073693 ACTGCGAGGCAGAAGGAGTGAGG + Intergenic
1143273629 17:5693948-5693970 AGTGCCCAGCACAAGGTGGGTGG + Intergenic
1143602058 17:7953603-7953625 ACTGCAAAGCACGAGGTGAGCGG - Intergenic
1143976894 17:10836905-10836927 ACTGGCAAGCTGGAGCTGGGTGG - Intronic
1144026665 17:11282805-11282827 GCTGCCAAGCAGCAAGTGGGAGG + Intronic
1147713352 17:42486472-42486494 AGTGCCAAGACTAAGGTGGGAGG - Intronic
1148229176 17:45920541-45920563 GCTGCCAGGCAGAAGGTGCACGG - Intronic
1151194224 17:72420492-72420514 ACTGTCAAGCAGGAGGAGGGAGG - Intergenic
1151451369 17:74200247-74200269 ACTTCCAGACAGAAGGAGGGAGG - Intergenic
1151509492 17:74549597-74549619 ACAGACAGGCAGAAGGTGGAGGG - Intergenic
1152551243 17:81031412-81031434 GCTGCCAGGCAGAAGGTGGGAGG + Intergenic
1152931694 17:83113372-83113394 AGTGCCCAGAACAAGGTGGGAGG - Intergenic
1155090462 18:22504253-22504275 ACTTGCAAGCAGAAGATGGTGGG - Intergenic
1156278002 18:35603286-35603308 AGTGCCTAGCAGATTGTGGGAGG + Intronic
1157449937 18:47778405-47778427 GCTGCCCAGCAGGAGGTGAGTGG - Intergenic
1157710155 18:49844464-49844486 ACTGCCCACCTGCAGGTGGGAGG - Intronic
1158306843 18:56115500-56115522 CCGGACAAGCAGAAGTTGGGAGG - Intergenic
1158570672 18:58594819-58594841 ACGGTCCTGCAGAAGGTGGGAGG - Intronic
1158909529 18:62046354-62046376 GCTGCAAAGCAGGAGGTGAGTGG + Intronic
1159599404 18:70414275-70414297 GATGCCAAGCAGAGGATGGGAGG - Intergenic
1160861831 19:1240401-1240423 ACGGCCAGGCAGGAGGTGGGGGG + Intergenic
1161320253 19:3637739-3637761 ACTGCCAAGCAGAAGGTGGGGGG + Intronic
1161436415 19:4266300-4266322 AGTGCCAAGCTGACGGTGTGAGG - Intronic
1163154741 19:15433508-15433530 ACTGCGAGGCAGAGGGTTGGCGG - Intronic
1163263572 19:16205430-16205452 ATTGCCAGGCAGCAGGAGGGAGG + Intronic
1164494571 19:28748162-28748184 GCTGCAAAGCAGGAGGTGAGTGG + Intergenic
1164699621 19:30275355-30275377 ACTCCCCAGCAAAAGGTGGGTGG - Intronic
1165117588 19:33538199-33538221 ACTGCTGAGCAGAAGCCGGGAGG - Intergenic
1165553740 19:36611043-36611065 ACAGCCAAGGCCAAGGTGGGTGG + Intronic
1165677139 19:37736252-37736274 ACTCCCAAGCAGAATGTTGAAGG + Intronic
1166594005 19:44028252-44028274 CCAGCTAAGCAGAAAGTGGGAGG - Intronic
1166770709 19:45280452-45280474 CCTGCCCAGCAGGAGGTAGGTGG - Exonic
926345089 2:11937553-11937575 ACTGTCAAGCAGTAGTTTGGGGG + Intergenic
927510713 2:23642415-23642437 ACAGCCGGGCTGAAGGTGGGAGG - Exonic
927520368 2:23694746-23694768 TCTGCCAGGCACAAGGTGGATGG - Intronic
927644420 2:24867873-24867895 ACTAATAAGCAGAAAGTGGGGGG + Intronic
927750486 2:25665283-25665305 ACTGACAGGGAGATGGTGGGAGG - Intronic
927774754 2:25893945-25893967 ACTGCAAAGCAGTAGGTGTAGGG + Intergenic
928040555 2:27872115-27872137 GCTGCAAAGCAGGAGGTGAGTGG - Intronic
930228009 2:48813987-48814009 ACTTCCAGGCAGAAGATGTGAGG - Intergenic
930682470 2:54271641-54271663 GCTGCCAAGCAGAAGGACTGGGG - Intronic
933596693 2:84289921-84289943 GCTGCAGAACAGAAGGTGGGAGG + Intergenic
934569895 2:95362743-95362765 GCTGCACAGCAGGAGGTGGGCGG - Intronic
934884225 2:98010452-98010474 AGTGAGAAGCAGAAGGTGTGTGG - Intergenic
935206619 2:100901849-100901871 ACAGGAAAGCAGAAGGCGGGTGG - Intronic
936487910 2:112942536-112942558 ACTGCCAACCTGAAGGGGCGCGG - Intergenic
936495861 2:113020368-113020390 GCTGCACAGCAGAAGGTGAGTGG - Intergenic
937070085 2:119056701-119056723 ATTGCCAAGGAGCAGGTGAGGGG - Intergenic
938131591 2:128720245-128720267 ACTGGAAAGCAGATGGTGAGTGG + Intergenic
938236453 2:129710148-129710170 ACTGCCCAGCAGTAGGTGCCAGG + Intergenic
938411585 2:131069103-131069125 ACTGCCTAGCAGAGGCAGGGTGG - Intronic
939148458 2:138444695-138444717 GCTCCCAAGCAGAAGGAGAGAGG - Intergenic
939457256 2:142453585-142453607 ACAGCAATGCAGAAGGTGGGAGG + Intergenic
939687919 2:145222840-145222862 ATTGGCACTCAGAAGGTGGGTGG - Intergenic
940092728 2:149938944-149938966 GCTGCAGAGCAGAAGGAGGGAGG - Intergenic
940453903 2:153872568-153872590 AAAGCAGAGCAGAAGGTGGGCGG - Intronic
941110539 2:161415606-161415628 AGCGACAAGCAGAAGGGGGGAGG - Intergenic
941114450 2:161455917-161455939 ACTGCAAAGTAGAAGGTCAGTGG - Intronic
941784998 2:169488553-169488575 GCTGCCCAGCAGGAGGTGAGTGG - Intronic
943374670 2:187061550-187061572 ATAGCCAAGAAGCAGGTGGGAGG + Intergenic
943971415 2:194412286-194412308 ACAGCAAAGAAGAAAGTGGGAGG - Intergenic
944300011 2:198112899-198112921 ATTACCAGGAAGAAGGTGGGTGG + Intronic
944338776 2:198569945-198569967 GCTGCCAAGCAGGAGGTGAGCGG - Intronic
946002103 2:216491034-216491056 ACTGCAGAGCAGTAGGTGGAAGG - Intergenic
946054571 2:216889515-216889537 ACTGCCAAGGGGATCGTGGGAGG - Intergenic
946077485 2:217086590-217086612 ACTGCCAAGCAGAAGCAGTGAGG + Intergenic
948530493 2:238600554-238600576 ACAGCCAAGCAGAAGGCGAGAGG - Intergenic
948684451 2:239661418-239661440 ACTGTCAAGCAGAAAGTGAGAGG - Intergenic
1169832542 20:9839647-9839669 GCAGCCAAGGAGAAGCTGGGTGG - Intergenic
1170018828 20:11813262-11813284 GCTGCAAAGCAGAAGCTGAGTGG - Intergenic
1171168671 20:22995881-22995903 ATGGCCAAGCAGAGGGAGGGAGG - Intergenic
1171202023 20:23249784-23249806 TCTGCTCAGCAGAAGGTGGTGGG + Intergenic
1171395777 20:24832248-24832270 GCTGCCATGGGGAAGGTGGGAGG - Intergenic
1172826466 20:37791629-37791651 AATGCACAGCAGAAGGTGAGCGG + Intronic
1172889983 20:38257249-38257271 ACTGCCATGCAGCAGGTATGTGG + Intronic
1173280128 20:41619561-41619583 ACTGCCAAGGTTAGGGTGGGAGG - Intergenic
1173456113 20:43203007-43203029 ACTGCCAGGCCGAAGATGGATGG + Intergenic
1173461871 20:43249334-43249356 ACTGCCAGCCAGGAGGTAGGTGG + Intergenic
1175272332 20:57743188-57743210 TCTGCAAAGCAGCAGCTGGGAGG - Intergenic
1175375743 20:58522764-58522786 ACTTGCAAGCTGATGGTGGGGGG - Intergenic
1175602557 20:60286860-60286882 TCTGCCATGCAGAAAGGGGGTGG - Intergenic
1176257716 20:64160803-64160825 GCTGCCCTGCAGAAGGTTGGAGG + Intronic
1176303804 21:5113245-5113267 GCTGGCCAGCAGTAGGTGGGAGG + Intergenic
1177215648 21:18124335-18124357 AGGGCCAAGCACATGGTGGGTGG - Intronic
1178189957 21:30268879-30268901 TCTTCAAATCAGAAGGTGGGAGG - Intergenic
1178542757 21:33468618-33468640 ATTGCCAAGCAGAATATGGTAGG - Intronic
1178595818 21:33951419-33951441 GGGGCAAAGCAGAAGGTGGGAGG + Intergenic
1179853226 21:44148705-44148727 GCTGGCCAGCAGTAGGTGGGAGG - Intergenic
1181640109 22:24191745-24191767 GCTGCCAAGGAGGAGGCGGGGGG + Intergenic
1182979434 22:34654615-34654637 ACTGCACAGCAGGAGGTGAGCGG - Intergenic
1183278846 22:36921623-36921645 ACTGGCAAGCAGAGGGTGGGGGG + Intronic
1183583871 22:38740881-38740903 CTTGCCAAGCAGATGGTAGGGGG - Intronic
1183722175 22:39568923-39568945 ACAGCCCAGCAGCAGCTGGGTGG + Intergenic
1184033527 22:41908202-41908224 ACAGCCCAGCAGGGGGTGGGAGG + Intergenic
1184413614 22:44339585-44339607 ACTGTGAAACAGCAGGTGGGTGG + Intergenic
1184583667 22:45433716-45433738 ATTGCCAGGCAGGAGGTGTGGGG + Intergenic
1184819360 22:46897541-46897563 TCTGCCACGCAGAAGAGGGGTGG + Intronic
950213385 3:11140336-11140358 ACTGCCACGCCTAAGGAGGGAGG - Intronic
950499307 3:13353723-13353745 ACTGCAAATCAGAAGGAGGGAGG - Intronic
951207807 3:19942883-19942905 GCTGCCCAGCAGGAGGTGAGTGG - Intronic
953229507 3:41052144-41052166 ACTTCCAACTGGAAGGTGGGAGG + Intergenic
953300319 3:41767968-41767990 GCTGCACAGCAGAAGGTGAGCGG + Intronic
953547953 3:43878037-43878059 ACTTTTAAACAGAAGGTGGGAGG - Intergenic
954303151 3:49711839-49711861 AGTGCAAAGGAGAAGGTGGTGGG - Intronic
954820883 3:53326511-53326533 GCTGCACAGCAGAAGGTGAGTGG + Intronic
958771261 3:98428649-98428671 ACTGCCACCCAGGAGGTGGCAGG - Intergenic
958781110 3:98543440-98543462 ACTGAAGAGCAGAAGGTGGAAGG - Intronic
958897341 3:99843783-99843805 AGCGGCAAGCAGAAGGTGAGTGG + Intronic
960908988 3:122629966-122629988 ACTGCCCAGCAGGAGGTGAGCGG - Intronic
961067091 3:123884570-123884592 ACTCCGAGGCAGAAGGCGGGTGG - Intergenic
961084794 3:124057625-124057647 ACTCCCAAGCAGAAGGAGCCTGG + Intergenic
961105158 3:124234680-124234702 ACTGCTTAGGACAAGGTGGGGGG - Intronic
961904175 3:130245382-130245404 ACTGAGAACCAGAAGGTGGTAGG + Intergenic
963102191 3:141618386-141618408 ACTGACAGGCAGAATGTGGAAGG + Intergenic
963155516 3:142091860-142091882 GCTGCATAGCAGAAGGTGAGCGG - Intronic
963914088 3:150841564-150841586 TCTGCCACGCAGAAAGTTGGGGG - Intergenic
965385034 3:168035635-168035657 ACGGCCTATCAGAAGGTGGAGGG + Intronic
966392264 3:179465194-179465216 ACTGCCAAACTGAAGTTGGTTGG + Intergenic
966978151 3:185104804-185104826 ACTGCATACCAGAAGGTGGAGGG + Intronic
968432914 4:569180-569202 GCTGCCAAGCCCATGGTGGGGGG + Intergenic
968554195 4:1239001-1239023 AATGCCAGGCAGAGGGTTGGGGG - Intronic
968612309 4:1562865-1562887 AGGGCCGAGCAGAAGGAGGGTGG + Intergenic
968862218 4:3181755-3181777 ACTGGCAAGCAGGTGGTGGCAGG + Intronic
968978393 4:3833817-3833839 GTAACCAAGCAGAAGGTGGGCGG - Intergenic
969467436 4:7366140-7366162 CCTGCCAAGGAGGAGGAGGGTGG - Intronic
969724503 4:8911294-8911316 AGTGCTAAGGAGAAGATGGGGGG - Intergenic
970451064 4:16166865-16166887 ATGGCTAAGGAGAAGGTGGGGGG + Intronic
970889004 4:21020832-21020854 AAAGCCAAGGAGAAGTTGGGAGG + Intronic
971032938 4:22660572-22660594 ACTGCACAGCAGAAGGTGAGTGG + Intergenic
972246753 4:37253003-37253025 ACTGCAAAACATAAGGGGGGGGG - Intronic
973590653 4:52437368-52437390 CCTGCCTAGCAGGAGATGGGAGG + Intergenic
977914531 4:102577001-102577023 ATTTGCAAGCAGAAGGTGGAGGG + Exonic
978825381 4:113016361-113016383 ACTGCCAAGCAGAAACTTGGCGG - Intronic
982067531 4:151667613-151667635 AATGACCAGGAGAAGGTGGGTGG + Intergenic
982346559 4:154366907-154366929 AGTGCTAAGAAGAAGGTGTGAGG + Intronic
984021746 4:174493314-174493336 ACTGCCAATTAGAAGGTTGTAGG + Exonic
985652693 5:1114239-1114261 CCTGCCAGGCAGAAGGCAGGTGG + Intergenic
985653001 5:1115714-1115736 CCTGCCAGGCAGAAGGCGGGTGG - Intergenic
985932257 5:3067789-3067811 AGTGACAAGCAGAAGGTTGCAGG - Intergenic
986069156 5:4265337-4265359 AATTCCAGGCAGCAGGTGGGAGG + Intergenic
986286358 5:6361986-6362008 AGTGCCAAGCAGAAGAGGGCAGG + Intergenic
988007515 5:25436251-25436273 ACTGGGAAGCAGCAGGTGAGTGG + Intergenic
988518945 5:31929105-31929127 ACAGCCATGCAGCAGGTGGATGG - Intronic
988626108 5:32876472-32876494 ACTGCACAGCAGGAGGTGAGCGG + Intergenic
989133028 5:38126232-38126254 AGTGCCATGGAGAAGATGGGAGG + Intergenic
989200086 5:38754558-38754580 TCTGGCAAGCACAAGGTGTGAGG - Intergenic
992582885 5:78200222-78200244 ACTGCCAAGCAGGGGGAGGGGGG + Intronic
994347840 5:98708644-98708666 ACTGCCAAAATGATGGTGGGAGG - Intergenic
996197206 5:120623371-120623393 ATTGCCTAGCACAAAGTGGGAGG + Intronic
996365129 5:122693088-122693110 ACTGACAAGGTGGAGGTGGGGGG - Intergenic
996831431 5:127744357-127744379 CCTGTCAAGCAGAAGGAGAGAGG + Intergenic
997446303 5:133942886-133942908 CCAGCCTAGCAGAAGGAGGGTGG + Intergenic
999619415 5:153457193-153457215 ACTGCATAGCATGAGGTGGGTGG + Intergenic
1000707771 5:164532981-164533003 ACTGCCAGGCAGCAGCTGGCTGG + Intergenic
1001447239 5:171794965-171794987 ATTGCCAAGAATGAGGTGGGAGG + Intergenic
1001746667 5:174098000-174098022 CCTTCCCAGCAGAAGGTGGCTGG + Intronic
1004025611 6:11815344-11815366 AATGCCAAGCTGGAGCTGGGAGG + Intergenic
1005153786 6:22780706-22780728 TCTTCCAAGCAGAAGGAGGAAGG - Intergenic
1005283310 6:24298257-24298279 ACTGCACAGCAGGAGGTGAGTGG - Intronic
1007110657 6:39311816-39311838 ACAGCAGTGCAGAAGGTGGGAGG + Intronic
1007288810 6:40768663-40768685 ACAGCCAGGCCAAAGGTGGGAGG + Intergenic
1007512240 6:42382432-42382454 GCTGCCAAGCAGAAGGCAGTAGG + Intronic
1007709000 6:43809721-43809743 ACTGCCATACAGAAGGCGGATGG + Intergenic
1008209474 6:48703112-48703134 GATGCCAAACTGAAGGTGGGAGG + Intergenic
1009813425 6:68699800-68699822 TCACCCAAGCAGTAGGTGGGGGG + Intronic
1010041001 6:71383666-71383688 ACTGCCCAGCAGGAGGTGAGTGG - Intergenic
1012898405 6:104978154-104978176 ACTGAAAAAAAGAAGGTGGGGGG - Intronic
1016189811 6:141251042-141251064 AATGTCAAACAGAAGGTGAGTGG + Intergenic
1017515450 6:155152258-155152280 ACTGCCAAGAAGAATGCAGGAGG + Intronic
1018664720 6:166125197-166125219 GCTGCACAGCAGAAGGTGAGTGG - Intergenic
1018755036 6:166841686-166841708 ACTGCTAAGGAAAAGGTGAGAGG + Intronic
1018901064 6:168051947-168051969 GCTGCCCAGCAGAAGGTGGTGGG - Intergenic
1019163169 6:170082302-170082324 ACCCCACAGCAGAAGGTGGGAGG - Intergenic
1019389328 7:776832-776854 ACTGCACAGCAGGAGGTGAGAGG + Intronic
1019695331 7:2442749-2442771 ACTGCACAGCAGGAGGTGAGCGG + Intergenic
1019731122 7:2630222-2630244 ACAGCCAGGCAGAAGGGGGGAGG - Intergenic
1019900291 7:4015223-4015245 ACGGCCACTCAGAAGCTGGGTGG - Intronic
1020087273 7:5317247-5317269 ACCAGCAAGCAGAAGGAGGGGGG + Intronic
1022160734 7:27708519-27708541 TCTGCAACACAGAAGGTGGGGGG - Intergenic
1024243842 7:47454900-47454922 AGTGCCCTGCAGCAGGTGGGAGG + Intronic
1024262141 7:47581235-47581257 GCTGACAAGCAGGAGGAGGGAGG - Intronic
1024306657 7:47934954-47934976 GCAGCTAAGCAGGAGGTGGGAGG + Intronic
1024487703 7:49938052-49938074 ACTGCAAAATAGAAGGTGAGTGG - Intronic
1024975344 7:55109048-55109070 GCTGCAAGGGAGAAGGTGGGAGG + Intronic
1025253961 7:57370527-57370549 AATGCCAAGGGGAAGGTGGATGG - Intergenic
1026316027 7:69228431-69228453 GCTGCACAGCAGAAGGTGAGCGG - Intergenic
1026336156 7:69395687-69395709 ACAGCCATGCAGAGGGTGAGTGG - Intergenic
1028768641 7:94589525-94589547 GCTGCCCAGCAGGAGGTGAGTGG + Intronic
1030171711 7:106609311-106609333 TCTGGCAAGCATAATGTGGGAGG - Intergenic
1030518707 7:110569570-110569592 ACTGACAAGCAGAAAGAAGGAGG - Intergenic
1030642921 7:112026193-112026215 ACCGCACAGCAGAAGGTGAGTGG + Intronic
1032795607 7:135273782-135273804 GCTGCACAGCAGAAGGTGAGTGG - Intergenic
1033452796 7:141476748-141476770 GCTGCAAAGCAGAAAGTGTGCGG - Exonic
1034226367 7:149486962-149486984 ACTGCACAGCAGGGGGTGGGTGG + Intronic
1035938363 8:3868117-3868139 TCTGCCAAGCAGAAAGTGCTAGG - Intronic
1036390235 8:8318698-8318720 AAGGCCAAGCAGAAGCCGGGCGG - Exonic
1036607062 8:10316886-10316908 ACTTTCCAGCAGAAGGTAGGAGG + Intronic
1042532914 8:69833169-69833191 CCTGCAAAGCAGAAAGAGGGCGG + Exonic
1045980856 8:108185583-108185605 ACTGCATAGCAGGAGGTGAGTGG - Intergenic
1046969988 8:120212136-120212158 GCTCCCCAGGAGAAGGTGGGTGG - Intronic
1047353207 8:124095525-124095547 ACTGGCAAGAAGAAGCTGTGTGG + Intronic
1048145325 8:131836315-131836337 ACTGCCAAGCAGAGGGTTGGTGG - Intergenic
1048445261 8:134488517-134488539 ACTCCAAAGCAGAGAGTGGGTGG - Intronic
1048695609 8:137024629-137024651 ACTGACAAACAGAAGATGGTGGG - Intergenic
1049368883 8:142254079-142254101 TCTGCCAAGAAGAAGGTGGAAGG - Intronic
1049602524 8:143514502-143514524 ACTGACATGCACACGGTGGGCGG + Intronic
1050412786 9:5383791-5383813 ACTGCCCAGCAGGAGATGAGCGG - Intronic
1050975559 9:11933423-11933445 ACTTGAAAGTAGAAGGTGGGAGG + Intergenic
1051614060 9:18990633-18990655 GCTGCACAGCAGAAGGTGAGTGG + Intronic
1052340609 9:27360913-27360935 AGAGCCAAGGAGAAGGTGGAGGG + Intronic
1053392270 9:37744492-37744514 ACAGCCAAGCAGGAGGGGAGGGG + Exonic
1053423632 9:37997031-37997053 GCTGACAGGCAGGAGGTGGGTGG + Intronic
1054785655 9:69207729-69207751 ATAGCCAAGCACAAGGTGGTGGG + Intronic
1055846408 9:80568907-80568929 GCTGCCCAGCAGGAGGTGAGTGG - Intergenic
1056502744 9:87225845-87225867 ACTGGCAGGCAGAAGGTGAGTGG - Intergenic
1060402219 9:123355712-123355734 ACTGGGGAGCAGCAGGTGGGGGG + Intergenic
1186187417 X:7035132-7035154 ACTTCTATACAGAAGGTGGGTGG - Intergenic
1186770450 X:12812809-12812831 GCTGCCAGGGATAAGGTGGGGGG - Intronic
1186813318 X:13211300-13211322 ACTGCCAGGAAAAATGTGGGGGG - Intergenic
1187098896 X:16172163-16172185 ACAGCCAAGCAGAGCGGGGGTGG + Intergenic
1187557701 X:20367796-20367818 GCTGCAAAGCAGGAGGTGAGTGG + Intergenic
1189279408 X:39810623-39810645 TCTGTCAAGCAGAAGGTGCCAGG - Intergenic
1189344227 X:40228366-40228388 GCTGCCCAGCAGGAGGTGAGTGG - Intergenic
1190737723 X:53266798-53266820 AATTCCAAGAAGAAGGTGGGGGG + Intronic
1190750753 X:53359543-53359565 TCTGGCAAGCAGAAAGGGGGCGG + Intergenic
1195318295 X:103699976-103699998 ACAGCCAAGCAGTAGGCGTGTGG + Intergenic
1195493254 X:105498873-105498895 GCTGCAAAGCAGGAGGTGAGTGG + Intronic
1196495113 X:116315973-116315995 AGTGCAAAGGAGAAAGTGGGTGG + Intergenic
1199655840 X:149994688-149994710 AATGCTGAGCAGGAGGTGGGGGG - Intergenic
1201592759 Y:15633703-15633725 AATTCCAGGCAGAAGGTGGAAGG + Intergenic
1202603487 Y:26618443-26618465 GCTGCGCAACAGAAGGTGGGGGG - Intergenic