ID: 1161320613

View in Genome Browser
Species Human (GRCh38)
Location 19:3639091-3639113
Sequence GACCGTATGAAGCCCCTGCC TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 89
Summary {0: 1, 1: 0, 2: 0, 3: 5, 4: 83}

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1161320613_1161320616 13 Left 1161320613 19:3639091-3639113 CCAGGCAGGGGCTTCATACGGTC 0: 1
1: 0
2: 0
3: 5
4: 83
Right 1161320616 19:3639127-3639149 AAAGCCAGGCAGCTGACCACAGG 0: 1
1: 0
2: 1
3: 34
4: 227
1161320613_1161320615 -1 Left 1161320613 19:3639091-3639113 CCAGGCAGGGGCTTCATACGGTC 0: 1
1: 0
2: 0
3: 5
4: 83
Right 1161320615 19:3639113-3639135 CATCACGGAGATGAAAAGCCAGG 0: 1
1: 0
2: 0
3: 16
4: 151

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1161320613 Original CRISPR GACCGTATGAAGCCCCTGCC TGG (reversed) Intronic
900114775 1:1023847-1023869 GTCCGTGGGGAGCCCCTGCCAGG + Intronic
902210543 1:14901467-14901489 GACCATGTGACTCCCCTGCCTGG - Intronic
903173157 1:21565923-21565945 GCCCGTGTGAAGTCGCTGCCGGG + Intronic
903834050 1:26191229-26191251 CACCATAGGAAGCCTCTGCCTGG - Intronic
907046391 1:51302641-51302663 GACCCTGGGAAGCCCCTGCTGGG - Intronic
920433583 1:205934359-205934381 GACCTGATGGAGCCCCTGCAGGG - Intronic
922699027 1:227747423-227747445 GACAGTGTGAACCCTCTGCCTGG + Intronic
1073486164 10:103820416-103820438 GACCAGATGCAGCCCCTGGCAGG - Intronic
1077408497 11:2393014-2393036 GGCCAGATGAAGCCTCTGCCAGG - Intronic
1078335474 11:10459729-10459751 GACTGTGAGGAGCCCCTGCCCGG + Intronic
1080286060 11:30614210-30614232 GACCTTATGATCCCCCTGCCTGG + Intergenic
1088686686 11:112290040-112290062 TGCCGTAGGAAGCCCCTGCCAGG + Intergenic
1090382444 11:126336810-126336832 AACCGAATGAGGCCCCTTCCTGG - Intronic
1094042242 12:26130329-26130351 GACCGTATGAAGCCCATAGTGGG - Intronic
1100682846 12:96947930-96947952 GACCATAGGCAGCCTCTGCCTGG + Intronic
1101613167 12:106310410-106310432 GACCGCATGAAACCTCTGGCTGG - Intronic
1101838236 12:108310075-108310097 GAGGGTATGAAGCCTTTGCCAGG + Intronic
1106504715 13:30361027-30361049 AACCATATGAAGCCAGTGCCTGG + Intergenic
1112039680 13:95534297-95534319 AACCATATGAAGCTACTGCCAGG + Intronic
1128358103 15:66942571-66942593 GACCGCATGATCCACCTGCCTGG - Intergenic
1131628904 15:94154731-94154753 GATCGTCCCAAGCCCCTGCCTGG + Intergenic
1132662762 16:1068968-1068990 GACCGCGTGAAGCACCTCCCGGG + Intergenic
1133292120 16:4729160-4729182 GACAATATAAAGCCCCTGGCAGG - Intronic
1133617996 16:7497107-7497129 GACCATGTGAATCCCATGCCTGG + Intronic
1135983468 16:27166790-27166812 GCCCCTATGAAGCCCCTTCAAGG + Intergenic
1136933302 16:34437151-34437173 GACTGCGTGAAGCCCCTGCCTGG + Intergenic
1136971270 16:34974663-34974685 GACTGCGTGAAGCCCCTGCCTGG - Intergenic
1142716385 17:1749193-1749215 GACCTTATGATCCACCTGCCTGG - Intronic
1144637959 17:16923080-16923102 CACTGTAGGAAGCCCCTACCTGG - Intergenic
1144676260 17:17164137-17164159 GACTCTATGGAGCCTCTGCCAGG - Intronic
1147336749 17:39730667-39730689 GACCGGACCCAGCCCCTGCCCGG - Exonic
1148135016 17:45286639-45286661 GACAGTCCAAAGCCCCTGCCTGG - Exonic
1149495848 17:57116906-57116928 GACAGTGTGATGCCCCTGTCAGG + Exonic
1152189881 17:78881949-78881971 GAGGATATGGAGCCCCTGCCAGG - Intronic
1160492306 18:79348543-79348565 AACAGGATGAAGCCCCAGCCAGG - Intronic
1161320613 19:3639091-3639113 GACCGTATGAAGCCCCTGCCTGG - Intronic
1162181006 19:8868641-8868663 GTCCATATGGGGCCCCTGCCTGG + Intronic
1163411929 19:17160328-17160350 CACAGAATGCAGCCCCTGCCTGG - Intronic
1164062883 19:21690723-21690745 GACAGTATGAGGTCCCTTCCAGG + Intergenic
1165532875 19:36418599-36418621 GAACGGAGGAAGCCGCTGCCGGG + Exonic
1168616322 19:57839846-57839868 GACCTTATGATCCACCTGCCAGG - Intronic
925130507 2:1490712-1490734 GATCTAATGAAGCCTCTGCCAGG - Intronic
926056853 2:9778800-9778822 CACCCGCTGAAGCCCCTGCCTGG + Intergenic
926324552 2:11773240-11773262 GGCGGTATAAAACCCCTGCCAGG - Intronic
926957984 2:18322603-18322625 GCCTGTTTGAAGCCCATGCCAGG - Intronic
928639999 2:33288338-33288360 GACTGTCTCAAGCCCCTCCCTGG - Intronic
935705302 2:105851487-105851509 GACCTCGTGAAGCGCCTGCCTGG + Intronic
937262922 2:120597899-120597921 GACCCTCTGCAGCCTCTGCCTGG - Intergenic
940377001 2:152968450-152968472 GACTATACTAAGCCCCTGCCAGG - Intergenic
942332916 2:174847576-174847598 CACCCTATGAAGCCCCTAGCAGG + Intronic
1174110306 20:48194017-48194039 GACTCTGTGGAGCCCCTGCCTGG + Intergenic
1175934334 20:62508161-62508183 GACCGTGTGCTGGCCCTGCCTGG + Intergenic
1176267309 20:64216962-64216984 GACGCTGTGAGGCCCCTGCCTGG + Intronic
1180870322 22:19142880-19142902 GACCGTCTGGAGGCCCTGCAAGG + Exonic
1184431910 22:44445945-44445967 GACCGCACAAAGCCCCTCCCTGG - Intergenic
968917968 4:3505494-3505516 GGCCGCAGGAGGCCCCTGCCAGG - Intergenic
969110207 4:4839712-4839734 GTCCTTCTGGAGCCCCTGCCAGG + Intergenic
985800608 5:2003413-2003435 GAGAGGATGGAGCCCCTGCCCGG - Intergenic
986441592 5:7787253-7787275 GCCAAGATGAAGCCCCTGCCTGG - Intronic
986784761 5:11104005-11104027 GACTGTATGAAGCCTGTGACAGG - Intronic
991490088 5:67174237-67174259 GACCACATGAATGCCCTGCCTGG + Intergenic
991934583 5:71789359-71789381 GACAGTATGAACCTCCTGACTGG - Intergenic
991974433 5:72172209-72172231 GACCTTAAGAAGTCCCTTCCTGG + Intronic
995281440 5:110340026-110340048 GACAGAATGAACCCCCTGCTTGG - Intronic
1001021938 5:168190477-168190499 GACCGTATCAAGCTCTTGGCAGG + Exonic
1003129092 6:3379825-3379847 AACCCTTTGAAGCCCCTGCTGGG - Intronic
1006501603 6:34462829-34462851 GACGGAATGAAGCCCAGGCCTGG - Intergenic
1010040627 6:71378698-71378720 GGCCTTATGAAGCCCAAGCCAGG - Intergenic
1024212081 7:47215145-47215167 GTGGTTATGAAGCCCCTGCCTGG + Intergenic
1029315112 7:99704729-99704751 GACCTTATGATCCACCTGCCTGG - Intronic
1035559050 8:591395-591417 GATGAGATGAAGCCCCTGCCAGG - Intergenic
1036635974 8:10549656-10549678 GACGTCAGGAAGCCCCTGCCTGG - Intronic
1037014368 8:13884096-13884118 GACCTTATGATCCACCTGCCTGG + Intergenic
1041710287 8:60888173-60888195 AACTATATGAAGCCTCTGCCAGG - Intergenic
1046969409 8:120204868-120204890 GACCACATGAAGAGCCTGCCTGG - Intronic
1048173274 8:132129107-132129129 GGCTGTGGGAAGCCCCTGCCTGG + Exonic
1048265130 8:132979054-132979076 GACTGTTTGCAGCCCCTTCCTGG + Intronic
1052515306 9:29472461-29472483 GACTGGCTGAAGCCCCTGCAGGG + Intergenic
1054930621 9:70631170-70631192 CACCAGATGAAGCCCCTACCGGG - Intronic
1061959200 9:133979446-133979468 GTCCTCATGCAGCCCCTGCCTGG - Intronic
1062015477 9:134289075-134289097 GCCCTTGTGAAGGCCCTGCCAGG + Intergenic
1062065800 9:134525563-134525585 CACCGTATGAACCCCCAGCATGG - Intergenic
1062162210 9:135086957-135086979 GACCTTATGCAGCTCCTGCCGGG + Intronic
1185786763 X:2897621-2897643 GACCCTGGGAAGCTCCTGCCCGG - Intergenic
1190882715 X:54504247-54504269 GAGTGAATGAAGCTCCTGCCCGG - Intergenic
1196167968 X:112555829-112555851 TCCCACATGAAGCCCCTGCCTGG - Intergenic
1197731823 X:129817218-129817240 GACCTCATGATTCCCCTGCCTGG - Intronic
1197794187 X:130282931-130282953 GAATGTAGTAAGCCCCTGCCAGG + Intergenic
1200917201 Y:8581793-8581815 CACCTTATGAAGCACCTGCTTGG - Intergenic