ID: 1161321379

View in Genome Browser
Species Human (GRCh38)
Location 19:3643239-3643261
Sequence CGGAGCAGCCGCGGTACAGG TGG (reversed)
Strand -
Crispr in exon? Yes
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 77
Summary {0: 1, 1: 0, 2: 0, 3: 2, 4: 74}

Found 8 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1161321379_1161321385 -8 Left 1161321379 19:3643239-3643261 CCACCTGTACCGCGGCTGCTCCG 0: 1
1: 0
2: 0
3: 2
4: 74
Right 1161321385 19:3643254-3643276 CTGCTCCGACGTCTCCGAGGGGG 0: 1
1: 0
2: 0
3: 2
4: 35
1161321379_1161321389 7 Left 1161321379 19:3643239-3643261 CCACCTGTACCGCGGCTGCTCCG 0: 1
1: 0
2: 0
3: 2
4: 74
Right 1161321389 19:3643269-3643291 CGAGGGGGACCGCTCAGGAATGG 0: 1
1: 0
2: 0
3: 5
4: 93
1161321379_1161321387 2 Left 1161321379 19:3643239-3643261 CCACCTGTACCGCGGCTGCTCCG 0: 1
1: 0
2: 0
3: 2
4: 74
Right 1161321387 19:3643264-3643286 GTCTCCGAGGGGGACCGCTCAGG 0: 1
1: 0
2: 0
3: 1
4: 43
1161321379_1161321393 19 Left 1161321379 19:3643239-3643261 CCACCTGTACCGCGGCTGCTCCG 0: 1
1: 0
2: 0
3: 2
4: 74
Right 1161321393 19:3643281-3643303 CTCAGGAATGGAGAGGGATGTGG 0: 1
1: 0
2: 8
3: 64
4: 524
1161321379_1161321390 12 Left 1161321379 19:3643239-3643261 CCACCTGTACCGCGGCTGCTCCG 0: 1
1: 0
2: 0
3: 2
4: 74
Right 1161321390 19:3643274-3643296 GGGACCGCTCAGGAATGGAGAGG 0: 1
1: 0
2: 0
3: 13
4: 138
1161321379_1161321383 -10 Left 1161321379 19:3643239-3643261 CCACCTGTACCGCGGCTGCTCCG 0: 1
1: 0
2: 0
3: 2
4: 74
Right 1161321383 19:3643252-3643274 GGCTGCTCCGACGTCTCCGAGGG 0: 1
1: 0
2: 0
3: 3
4: 33
1161321379_1161321391 13 Left 1161321379 19:3643239-3643261 CCACCTGTACCGCGGCTGCTCCG 0: 1
1: 0
2: 0
3: 2
4: 74
Right 1161321391 19:3643275-3643297 GGACCGCTCAGGAATGGAGAGGG 0: 1
1: 0
2: 0
3: 10
4: 127
1161321379_1161321384 -9 Left 1161321379 19:3643239-3643261 CCACCTGTACCGCGGCTGCTCCG 0: 1
1: 0
2: 0
3: 2
4: 74
Right 1161321384 19:3643253-3643275 GCTGCTCCGACGTCTCCGAGGGG 0: 1
1: 0
2: 0
3: 2
4: 38

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1161321379 Original CRISPR CGGAGCAGCCGCGGTACAGG TGG (reversed) Exonic
901089946 1:6634533-6634555 CGGAGCAAGCGCCGCACAGGTGG - Exonic
906024080 1:42658349-42658371 GGGAGCAGGCGCGGTAGACGTGG - Intergenic
911052364 1:93681684-93681706 GGGAGCAGCCGCGGCGCGGGCGG - Intronic
1067848054 10:49738563-49738585 CTGAGCACCTGCTGTACAGGAGG + Intronic
1069769518 10:70888467-70888489 CGGGGCAGCCGCGGGCGAGGTGG - Intronic
1071523757 10:86346603-86346625 CGGAGCAGACGCTGCCCAGGAGG + Intronic
1072591643 10:96832780-96832802 CGGCGCTGCCGCTGTACTGGGGG + Intronic
1073403306 10:103276468-103276490 GGGAGAAGCGGCGGTACAGAGGG - Intergenic
1083572629 11:63768573-63768595 CGGAGCAGCGGCGGCAGGGGCGG - Exonic
1084175754 11:67421320-67421342 GGGACCAGCCGCGCTAGAGGCGG + Intronic
1084946146 11:72639702-72639724 CGGAGCAGGCGCTGGACAGGCGG - Intronic
1086091042 11:83005037-83005059 AGGAGCAGCCACAGCACAGGTGG - Intronic
1090279819 11:125446062-125446084 TGGAGCAGCCTCGCTGCAGGAGG - Exonic
1091675920 12:2489392-2489414 GGGAGCAGCCCCGGTGAAGGCGG + Intronic
1099202063 12:79689882-79689904 CGGTGCAGCCGAGGCAGAGGCGG + Exonic
1104627977 12:130375483-130375505 CAGAGCAAACGCGGTTCAGGTGG - Intergenic
1105025886 12:132848677-132848699 GGGTGCAGCCCCAGTACAGGTGG + Exonic
1117302176 14:54440973-54440995 TGGGGCGGCCGCGGTCCAGGCGG - Intronic
1121781220 14:96623791-96623813 CGGAGCTGCAGCAGTAGAGGAGG - Intergenic
1122959420 14:105087662-105087684 CGGAGCAGCGGCGGGGCGGGCGG + Intergenic
1125557065 15:40594616-40594638 CGGAGGGGCCGAGGTGCAGGCGG - Intronic
1127753498 15:62068210-62068232 CGGAGCGGACGCGGGTCAGGCGG - Exonic
1127763559 15:62164381-62164403 CGGAGCGGACGCGGGCCAGGCGG + Exonic
1131031047 15:89186189-89186211 CCAAGCAGCAGCGGGACAGGAGG + Intronic
1131168264 15:90158382-90158404 CGGGGCAGCCACAGTACAGATGG + Intergenic
1133186895 16:4106394-4106416 CGGTGCTGCCGCGGAACAGAAGG - Intronic
1134128163 16:11630469-11630491 TGGAGCAGGCGGGGCACAGGAGG - Intronic
1136498816 16:30659618-30659640 CGGCGCCGCCGAGGTCCAGGCGG + Exonic
1138016614 16:53434450-53434472 CGGCGCAGGCGCGGTGCGGGCGG + Exonic
1141840130 16:86568577-86568599 CGGGGCCGCCGCGGCGCAGGCGG + Exonic
1142500732 17:331539-331561 CGGAGCAACCTCGGGACAGATGG + Intronic
1143585714 17:7849230-7849252 AGGAGCATCGGCGGCACAGGCGG + Exonic
1146358987 17:32159201-32159223 AGGAGCAGGAGAGGTACAGGTGG - Intronic
1147393216 17:40122463-40122485 CGGAGGAGCCGCGCTAGCGGAGG + Intronic
1148437165 17:47693964-47693986 CGGAGCAGCCGGGGAGGAGGAGG + Intergenic
1149599709 17:57885524-57885546 CGGAGCAGCAGCGGCAGCGGCGG - Exonic
1152543586 17:80989549-80989571 CAGAGCAGCAGCAGGACAGGGGG + Intergenic
1155461525 18:26090096-26090118 CGAAGCAGCCGCGGCACGCGGGG + Intronic
1156461897 18:37325979-37326001 TGGAGCAGGCTCTGTACAGGTGG + Intronic
1160455506 18:78996193-78996215 CGCAGCAGCAGCGGTAGAGCGGG + Intronic
1160518939 18:79493612-79493634 CGGAGCAGCTCCGGCTCAGGAGG - Intronic
1160539409 18:79612283-79612305 TGCAGCAGCCGCTGTGCAGGAGG + Intergenic
1161321379 19:3643239-3643261 CGGAGCAGCCGCGGTACAGGTGG - Exonic
1161778390 19:6276298-6276320 GGGAGCAGCCGAGTTGCAGGAGG + Intronic
1162240438 19:9348842-9348864 CAGCGCAGCCGGGGTACCGGAGG - Intronic
1162248682 19:9424476-9424498 CGGAGCAGCTGAGGTTCAAGTGG + Intronic
1163347980 19:16756717-16756739 CGGAGCAGTACCGGTACTGGGGG - Intronic
1165443163 19:35842393-35842415 CGGAGCAGCCGTCGTGCTGGAGG + Exonic
1167286961 19:48603712-48603734 CGGAGCGGCGGCGGGACACGCGG + Exonic
925058474 2:873230-873252 GGGAGGAGCCGCAGTTCAGGTGG - Intergenic
927173871 2:20392017-20392039 CAGAGCAGCAGAGGTACAAGGGG - Intergenic
1175943277 20:62547573-62547595 AGGAGCAGCCGGGGAGCAGGGGG - Intergenic
950153708 3:10707581-10707603 CGGAGCAGCCCCGGAGCTGGGGG - Intronic
954135653 3:48581005-48581027 CTGAGCAGCAGCTGGACAGGAGG + Intronic
964342000 3:155717635-155717657 CGGAGCAGCCGGGATGCAGGGGG + Intronic
968433082 4:570293-570315 CGGAGCATCCAGGGTGCAGGAGG - Intergenic
969528196 4:7714848-7714870 CTGAGCAGCACCAGTACAGGTGG - Intronic
980969384 4:139555549-139555571 CGTGGCAGCCGCGGCCCAGGCGG - Intronic
984734986 4:183099778-183099800 CGGAGGAGCCCGGGTACGGGCGG - Intronic
985413648 4:189713731-189713753 CGGCGCAGCCACTGTAGAGGTGG + Intergenic
990041492 5:51383056-51383078 CGGAGGAGCAGCGCCACAGGAGG + Intergenic
997926182 5:138032988-138033010 CGACGCAGACGCGGAACAGGGGG + Exonic
1002172186 5:177381537-177381559 AGGAGCAGCCACGGACCAGGAGG - Intronic
1002664147 5:180810415-180810437 CAGAGTAGCGGCCGTACAGGAGG + Intronic
1007345758 6:41228460-41228482 AGGAGCAGCAGCAGCACAGGTGG - Exonic
1018727762 6:166627036-166627058 CGGAGCAGCCGCAGGGCCGGGGG + Intronic
1019721558 7:2575434-2575456 CTGAGCAGGAGCAGTACAGGTGG - Intronic
1023810396 7:43906736-43906758 CGGAGCAGCCCGGGGACAGCTGG + Exonic
1048044095 8:130756944-130756966 GGGAGCAGCCCAGGTAAAGGAGG + Intergenic
1048293199 8:133195955-133195977 CGAAGCAGCCATGGTCCAGGTGG + Intronic
1049424207 8:142530837-142530859 AGGAGCAGGCGCGGTGCAGCTGG + Intronic
1057773157 9:97984458-97984480 CGCCGCCGCCGCGGCACAGGGGG - Intronic
1061257395 9:129460617-129460639 CCGAGCAGCCGGGCTGCAGGCGG - Intergenic
1061821930 9:133233788-133233810 AGGAGGAGCCGCAGTGCAGGGGG - Intergenic
1061958841 9:133977803-133977825 GGGAGCAGCCGAGGTCAAGGGGG + Intronic
1189445494 X:41076925-41076947 CGGAGCAGCCTTGGAGCAGGAGG + Intergenic
1199600771 X:149540088-149540110 GGGAGCAGCCGCGGGAGAAGCGG - Intergenic