ID: 1161323390

View in Genome Browser
Species Human (GRCh38)
Location 19:3651659-3651681
Sequence CTGGCTTCGCTCTGAGGCGC TGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 110
Summary {0: 1, 1: 0, 2: 0, 3: 10, 4: 99}

Found 7 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1161323377_1161323390 22 Left 1161323377 19:3651614-3651636 CCAAGGCCCGGAACCCTGCACTC 0: 1
1: 0
2: 1
3: 8
4: 194
Right 1161323390 19:3651659-3651681 CTGGCTTCGCTCTGAGGCGCTGG 0: 1
1: 0
2: 0
3: 10
4: 99
1161323379_1161323390 15 Left 1161323379 19:3651621-3651643 CCGGAACCCTGCACTCAGCCTGC 0: 1
1: 0
2: 0
3: 34
4: 340
Right 1161323390 19:3651659-3651681 CTGGCTTCGCTCTGAGGCGCTGG 0: 1
1: 0
2: 0
3: 10
4: 99
1161323386_1161323390 -10 Left 1161323386 19:3651646-3651668 CCCGCACTACGGCCTGGCTTCGC 0: 1
1: 0
2: 0
3: 5
4: 50
Right 1161323390 19:3651659-3651681 CTGGCTTCGCTCTGAGGCGCTGG 0: 1
1: 0
2: 0
3: 10
4: 99
1161323381_1161323390 9 Left 1161323381 19:3651627-3651649 CCCTGCACTCAGCCTGCGGCCCG 0: 1
1: 0
2: 0
3: 17
4: 169
Right 1161323390 19:3651659-3651681 CTGGCTTCGCTCTGAGGCGCTGG 0: 1
1: 0
2: 0
3: 10
4: 99
1161323382_1161323390 8 Left 1161323382 19:3651628-3651650 CCTGCACTCAGCCTGCGGCCCGC 0: 1
1: 0
2: 0
3: 13
4: 229
Right 1161323390 19:3651659-3651681 CTGGCTTCGCTCTGAGGCGCTGG 0: 1
1: 0
2: 0
3: 10
4: 99
1161323378_1161323390 16 Left 1161323378 19:3651620-3651642 CCCGGAACCCTGCACTCAGCCTG 0: 1
1: 0
2: 2
3: 45
4: 364
Right 1161323390 19:3651659-3651681 CTGGCTTCGCTCTGAGGCGCTGG 0: 1
1: 0
2: 0
3: 10
4: 99
1161323384_1161323390 -3 Left 1161323384 19:3651639-3651661 CCTGCGGCCCGCACTACGGCCTG 0: 1
1: 0
2: 0
3: 3
4: 99
Right 1161323390 19:3651659-3651681 CTGGCTTCGCTCTGAGGCGCTGG 0: 1
1: 0
2: 0
3: 10
4: 99

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1161323390 Original CRISPR CTGGCTTCGCTCTGAGGCGC TGG Intronic
902632385 1:17712840-17712862 CTGGCTGCTCTCTGAGGAGATGG + Intergenic
903512970 1:23890330-23890352 CTGCCTTGGCTCTCAGGCGAAGG - Intronic
903891510 1:26573259-26573281 CCTGCTTAGCTGTGAGGCGCTGG - Exonic
904483359 1:30807602-30807624 CTCGCTGCGCTCTGCGGAGCCGG + Intergenic
904723363 1:32527825-32527847 GTGGCTTCGCTCTGTCGCCCAGG - Intronic
905044452 1:34985045-34985067 CTGGCTTTCGACTGAGGCGCAGG - Intronic
905358159 1:37399234-37399256 CTGGCCTCGGTCTGAGCAGCTGG - Intergenic
906211001 1:44012107-44012129 CTGGCATCTCTCTGAGGCTACGG - Intronic
907804062 1:57800854-57800876 CTGTCTTAGCTCTGAGCTGCTGG + Intronic
908456394 1:64308735-64308757 ATGGCTTTGCTCTGAAGCTCTGG + Intergenic
916218783 1:162422265-162422287 CTGGCATTGCTCTGAGGGGTAGG - Intergenic
916472279 1:165136134-165136156 CTGTCTTCCCTCTGAGGCTAAGG - Intergenic
917145308 1:171884464-171884486 CTAGCTTCCCTATGAGGCACTGG + Intronic
918439794 1:184555666-184555688 CTGGCTTTACTCTCAGGAGCGGG + Intronic
919757334 1:201074251-201074273 CTGGCCAGGCTCTGAGGCTCTGG + Intronic
922705911 1:227789878-227789900 CTGGCTCCCCTCTTAGGGGCAGG + Intergenic
1066215001 10:33277551-33277573 CTGGCAACGCCCTGAGGCTCAGG - Intronic
1068862511 10:61861673-61861695 CTGGCCTCAATCTGAGGCTCAGG - Intergenic
1070594376 10:77821808-77821830 CAGGCTACGCTCAGAGGCACTGG + Exonic
1074100972 10:110354735-110354757 GTGGCTCCGCTCTGAGGATCTGG + Intergenic
1075399316 10:122150023-122150045 CTGGCTTCAGCCTGAGGAGCAGG + Intronic
1076561194 10:131365714-131365736 CTGGCTTCCCTCAGAGGAGGTGG - Intergenic
1076937240 10:133574722-133574744 CAGGCTCTGCTCTGAGGAGCTGG + Intergenic
1079008608 11:16810375-16810397 CCGGCTTCCCTCAGAGGGGCAGG - Intronic
1080395175 11:31883269-31883291 CTGGCTTTGCTCTGAGCACCCGG - Intronic
1082188049 11:49208331-49208353 CTGGCTGTGCGCTGGGGCGCTGG - Exonic
1083827289 11:65210967-65210989 CAGGGTTGGCTCTGAGGCCCAGG - Intronic
1084319783 11:68366918-68366940 CTGGCATTGCTCCGAGGCACTGG + Intronic
1084325622 11:68398277-68398299 CTAGCTGTGCTCTGAGGGGCAGG - Intronic
1084699807 11:70779064-70779086 CTGGCTTTGCTGTGGGGCCCAGG - Intronic
1086590773 11:88511259-88511281 CTGGCTTGCCTTTGAGGGGCTGG + Intronic
1088724406 11:112621402-112621424 CTGGATTAGCTCTGAGGCCAGGG + Intergenic
1088741287 11:112769484-112769506 CTGCCTCCTCTCTGAGGTGCGGG - Intergenic
1090441361 11:126728000-126728022 CTGGCTTCTCTCAGAGCTGCTGG - Intronic
1099066249 12:77983547-77983569 CTGGCTTCTCTCCTAGGCTCCGG - Intronic
1101706818 12:107228269-107228291 CTGGCTCTGTTCTGAGGCTCTGG + Intergenic
1106122592 13:26872989-26873011 CTGGCTTCTCTCTGGGTCCCAGG - Intergenic
1202905989 14_GL000194v1_random:72804-72826 CCGGCTTCACGCTGAGGCTCTGG - Intergenic
1125472988 15:40022662-40022684 CTGCCTTCACACTGAGGCCCGGG + Intronic
1127582492 15:60350471-60350493 GTGCCTTCGCTCTGATGCTCTGG - Intronic
1128181699 15:65610906-65610928 CTCCCCTCGCTCTGAGGCTCGGG - Intronic
1128455021 15:67827338-67827360 TTGGCTTGGCTCTGAGCAGCGGG - Intronic
1129221513 15:74134267-74134289 CTGGCTGCGCGCTGGGGCCCTGG + Exonic
1132763952 16:1525089-1525111 CTGGCATGGCTCTGAGGAGCCGG + Intronic
1132861355 16:2073299-2073321 CTGGGCTGGTTCTGAGGCGCAGG + Intronic
1135907956 16:26530817-26530839 TTGGCTTGGCTCTGATGCTCTGG + Intergenic
1139271337 16:65686210-65686232 CTGGCTTCTCCCTGAAGCTCTGG + Intergenic
1141216809 16:82032923-82032945 CTGGCTTAGCTGTGAGGCACTGG - Intergenic
1141424691 16:83937140-83937162 CTGTCTTCCCACTGAGGAGCAGG - Intronic
1146909791 17:36641428-36641450 CTGGGAGCGCTCTGGGGCGCGGG - Intergenic
1148911246 17:50944319-50944341 CAGGCTTGGCGCGGAGGCGCAGG + Intergenic
1149507063 17:57203286-57203308 CAGGCTTCTCTGTGAGGCCCAGG - Intergenic
1154413238 18:14154633-14154655 GTGGCTTCGTTCTGTGGCCCAGG + Intergenic
1160454851 18:78992970-78992992 GAGGCTGCGCTCTGCGGCGCTGG - Exonic
1160729044 19:632451-632473 CTGGCTTGGCTCTGGGGGGTAGG - Intronic
1161323390 19:3651659-3651681 CTGGCTTCGCTCTGAGGCGCTGG + Intronic
1162572630 19:11481843-11481865 CTGGCCTCTCTCTAAGGCGTTGG + Intronic
1167510383 19:49892705-49892727 CTGCCTTCCCTCTGAGGTCCTGG - Intronic
926113463 2:10196818-10196840 CTGTCTTCACTCTGAGGCCCTGG - Intronic
928077302 2:28276967-28276989 ATTGCTTTGTTCTGAGGCGCAGG + Intronic
929441383 2:41967917-41967939 CTGGCTGGGCTCTGGTGCGCCGG + Intergenic
933834318 2:86232909-86232931 CTGGATCAACTCTGAGGCGCAGG + Intronic
936452851 2:112646225-112646247 CTGGCTTCTCTCTTCGCCGCTGG + Intronic
938695687 2:133833508-133833530 CTGGGTTAGCCCTGAGGGGCAGG - Intergenic
939941988 2:148362200-148362222 CTTGCTGCGCTCTGTGGGGCTGG - Intronic
942107225 2:172644639-172644661 ATGGGTTAGCTCTGAGCCGCAGG + Intergenic
948826890 2:240577301-240577323 CTGGCCTCCCTCTGAGGAGCTGG - Intronic
1171891834 20:30724415-30724437 CCGGCTTCACGCTGAGGCTCTGG + Intergenic
1174733096 20:52937522-52937544 TTGGCTTAACACTGAGGCGCTGG - Intergenic
1176625346 21:9087560-9087582 CTGGCTTCACGCTGAGGCTCTGG - Intergenic
1176859774 21:14003612-14003634 GTGGCTTCGTTCTGTGGCCCAGG - Intergenic
1179928234 21:44550281-44550303 CTGGCCTGGCTCTGGGGGGCTGG - Intronic
1179939451 21:44628432-44628454 CTGGCCTGGCTCTGGGGGGCTGG + Intronic
1179998061 21:44983003-44983025 CTGTCGTTGCTCTGAGACGCTGG + Intergenic
1180205366 21:46256230-46256252 CTGGCATGGCCCTGAGGAGCCGG + Intronic
1180209389 21:46285803-46285825 CTGGCTTCCCTCGGAGCGGCTGG + Intronic
1184497042 22:44848107-44848129 CTGCCTCCGCTCTGAGGCCCCGG - Intronic
1184783134 22:46658956-46658978 CTGGCGGCACTGTGAGGCGCAGG - Intronic
950005389 3:9688018-9688040 CTGCCTTCGCTCTGAGGCCAGGG + Intronic
951906936 3:27715303-27715325 CCGGACTCGGTCTGAGGCGCAGG - Intergenic
962440844 3:135414877-135414899 CTGGCCTGGCTCTGAGGCAAGGG - Intergenic
964322989 3:155517279-155517301 AGGGCTTCGCTCTGTGGCTCAGG - Intronic
967689784 3:192460388-192460410 CTAGCTCCGCTCTGAGGCTGTGG - Intronic
969239300 4:5888548-5888570 CCGGCTTCGCTCCGCGCCGCCGG - Intronic
982712261 4:158769151-158769173 CCGGCTGCGCGCTGAGCCGCCGG + Exonic
983649747 4:170026359-170026381 CTCGCAACGCTGTGAGGCGCCGG - Exonic
992214122 5:74508636-74508658 CTGGCGTCGCTCAGAGGGGCTGG + Intergenic
1006424823 6:33957448-33957470 CTGGCTGGGCTCAGAGGTGCAGG - Intergenic
1015496805 6:133891265-133891287 CTGGCCTCCTTCTGAGGCGGTGG - Intronic
1017528597 6:155265265-155265287 CTGTCTTCTCTCTGAGGGACGGG - Intronic
1020213154 7:6170333-6170355 CGGGCATGGCTCTGAGGCCCCGG + Intronic
1026857105 7:73762244-73762266 CTGGCTACACTGTGAGGCCCAGG - Intergenic
1027390240 7:77696692-77696714 CTGCCATAGCTCTGAGGCGAAGG - Exonic
1028477290 7:91265677-91265699 CTTGCCTCGCTCCGACGCGCCGG - Exonic
1029432172 7:100538646-100538668 CTCCCTTCGCTCTGTGGCTCAGG + Intergenic
1034813357 7:154151301-154151323 CTGGCTTGTCTCTGAGCTGCGGG + Intronic
1035278595 7:157763404-157763426 CGGCCTTCGCTCTGAGGCACAGG + Intronic
1038467132 8:27774586-27774608 CTCGCCGGGCTCTGAGGCGCAGG + Exonic
1038865351 8:31433704-31433726 CTGGCTTGGCTCTGGGGTGAAGG + Intergenic
1039703928 8:39988455-39988477 CTGCCTTCGCTCTGTCGCTCAGG + Intronic
1039873708 8:41567783-41567805 CTGGCTTCATTCTGATGAGCAGG - Intergenic
1049719336 8:144108390-144108412 CGGGCTGCGCTCGGTGGCGCAGG + Exonic
1052244051 9:26312347-26312369 TTGGGTTCACTCTGAGGGGCTGG + Intergenic
1054356980 9:64071282-64071304 CCGGCTTCACGCTGAGGCTCTGG - Intergenic
1061037964 9:128123922-128123944 CTGGCTCCACTCTGAGGCTGGGG - Intronic
1203748520 Un_GL000218v1:58021-58043 CTGGCTTCACGCTGAGGCTCTGG - Intergenic
1186728841 X:12386142-12386164 CTGGTTTCACTCTGAAGGGCTGG - Intronic
1187098469 X:16169643-16169665 CTGGCTTCCCTCTCAGGCCTGGG + Intronic
1188245118 X:27829888-27829910 CTGGCATGGCTGTGAGGCTCAGG + Intergenic
1201161865 Y:11172991-11173013 CCGGCTTCACGCTGAGGCTCTGG - Intergenic