ID: 1161324292

View in Genome Browser
Species Human (GRCh38)
Location 19:3656021-3656043
Sequence GGGGCCCAAGGGTGACTCAG AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total
Summary

Found 6 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1161324292_1161324297 -9 Left 1161324292 19:3656021-3656043 CCTCTGAGTCACCCTTGGGCCCC No data
Right 1161324297 19:3656035-3656057 TTGGGCCCCTTGGGCCTCCGTGG No data
1161324292_1161324305 28 Left 1161324292 19:3656021-3656043 CCTCTGAGTCACCCTTGGGCCCC No data
Right 1161324305 19:3656072-3656094 TGCCCGCAGGCTGCTGGTTCTGG No data
1161324292_1161324303 15 Left 1161324292 19:3656021-3656043 CCTCTGAGTCACCCTTGGGCCCC No data
Right 1161324303 19:3656059-3656081 AGCTGACAGACGCTGCCCGCAGG No data
1161324292_1161324306 29 Left 1161324292 19:3656021-3656043 CCTCTGAGTCACCCTTGGGCCCC No data
Right 1161324306 19:3656073-3656095 GCCCGCAGGCTGCTGGTTCTGGG No data
1161324292_1161324308 30 Left 1161324292 19:3656021-3656043 CCTCTGAGTCACCCTTGGGCCCC No data
Right 1161324308 19:3656074-3656096 CCCGCAGGCTGCTGGTTCTGGGG No data
1161324292_1161324304 22 Left 1161324292 19:3656021-3656043 CCTCTGAGTCACCCTTGGGCCCC No data
Right 1161324304 19:3656066-3656088 AGACGCTGCCCGCAGGCTGCTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1161324292 Original CRISPR GGGGCCCAAGGGTGACTCAG AGG (reversed) Intronic