ID: 1161325372

View in Genome Browser
Species Human (GRCh38)
Location 19:3661141-3661163
Sequence GCACTAGGAGGGACCATGGC GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 544
Summary {0: 1, 1: 0, 2: 0, 3: 27, 4: 516}

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1161325372_1161325381 28 Left 1161325372 19:3661141-3661163 CCCGCCATGGTCCCTCCTAGTGC 0: 1
1: 0
2: 0
3: 27
4: 516
Right 1161325381 19:3661192-3661214 GCTCCAAGACTTCCTTGAAACGG 0: 1
1: 0
2: 1
3: 8
4: 135
1161325372_1161325379 1 Left 1161325372 19:3661141-3661163 CCCGCCATGGTCCCTCCTAGTGC 0: 1
1: 0
2: 0
3: 27
4: 516
Right 1161325379 19:3661165-3661187 TCTAGCAGCTGAGCCTCTAGCGG 0: 1
1: 0
2: 1
3: 11
4: 131

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1161325372 Original CRISPR GCACTAGGAGGGACCATGGC GGG (reversed) Intronic
900164143 1:1237975-1237997 GCAGCAGGAGGCACCACGGCCGG - Intergenic
900280696 1:1866184-1866206 GCACTTTGAGAGACCAAGGCGGG - Intronic
900402276 1:2477459-2477481 GCACGCTGAGGGACCCTGGCGGG - Intronic
900663595 1:3798723-3798745 GCACTTTGAGAGGCCATGGCGGG + Intergenic
900779372 1:4607742-4607764 GGACTAGGAGCCACCAGGGCTGG - Intergenic
901053145 1:6435762-6435784 CCACCAGGAGGGTCTATGGCTGG - Intronic
901053622 1:6438254-6438276 CCACCAGGAGGGTCTATGGCTGG - Intronic
901464876 1:9414884-9414906 GCACTTGGAGAGGCCAAGGCTGG - Intergenic
901745106 1:11367263-11367285 GCAGTGGGGGGGACCATGGAGGG + Intergenic
902078559 1:13805792-13805814 GTGCAAGGAGGGACCAGGGCAGG + Intronic
902466148 1:16620009-16620031 CCCCTAGGAGGCAGCATGGCGGG - Intergenic
902508545 1:16953295-16953317 CCCCTAGGAGGCAGCATGGCGGG + Exonic
902590301 1:17469238-17469260 GCACTTTGAGAGACCAAGGCGGG - Intergenic
902738664 1:18418767-18418789 GCACTTTGAGAGACCAAGGCAGG + Intergenic
902971833 1:20059184-20059206 GCACTTTGAGAGACCAAGGCAGG + Intronic
903458064 1:23502351-23502373 GCACTTGGAGAGGCCAAGGCGGG - Intergenic
904044526 1:27602020-27602042 GCACAAGGAGGGACCCTTGGGGG - Intronic
904770688 1:32879605-32879627 GCACTTTGAGAGACCAAGGCAGG - Intergenic
905882180 1:41471383-41471405 GCACTTGGGGGGGCCAAGGCAGG - Intergenic
906031274 1:42722135-42722157 GCACTTTGAGAGACCAAGGCAGG + Intergenic
906444034 1:45877955-45877977 GCACTTTGAGAGACCAAGGCGGG + Intronic
907226534 1:52952471-52952493 GCACTTTGAGGGGCCAAGGCAGG - Intronic
907552481 1:55316134-55316156 GCAATAGGTGGGAACATGCCAGG + Intergenic
910479805 1:87646236-87646258 GCACTAGTAAGGAACATGGGTGG + Intergenic
910528489 1:88208645-88208667 TCACTAGCAGGGACAGTGGCTGG - Intergenic
910646346 1:89519393-89519415 GCACTTTGAGGGGCCAAGGCAGG - Intergenic
912040502 1:105383812-105383834 GCACCAGGAGCCACCTTGGCTGG - Intergenic
912732752 1:112124233-112124255 GCACTTGGAGAGGCCAAGGCAGG - Intergenic
913197980 1:116473890-116473912 GCACTTTGAGAGACCAAGGCAGG - Intergenic
914738928 1:150447079-150447101 GCACTTTGCGGGACCAAGGCAGG - Intronic
915331011 1:155112344-155112366 GTCCCAGGAGGGGCCATGGCAGG + Intergenic
917947849 1:179994698-179994720 GCACTTGGAGAGACCAAGGTGGG - Intronic
918082610 1:181218997-181219019 GCTCTAGGAGGCACTGTGGCCGG + Intergenic
919216641 1:194564819-194564841 GCACTTGGAGAGGCCAAGGCGGG - Intergenic
919689323 1:200515193-200515215 GCACTCTGAGGGGCCAAGGCTGG - Intergenic
919715224 1:200769172-200769194 GCACTAGGAGGAACAAAGGATGG - Intronic
920522208 1:206635877-206635899 TCAGTAGGAGGGACGAGGGCAGG + Intronic
921527152 1:216231797-216231819 GCACTTTGAGAGACCAAGGCAGG - Intronic
921857506 1:220002611-220002633 GCACTTCGGGGGGCCATGGCAGG + Intronic
921921695 1:220676895-220676917 GCACTTTGGGAGACCATGGCAGG + Intergenic
922736830 1:227989693-227989715 GCACTTTGGGGGACCAAGGCAGG + Intergenic
922929701 1:229379383-229379405 ACACTAGGAGTGACCAAGGTAGG - Intergenic
923534900 1:234841600-234841622 GAACTTGCAGGGACCATGTCTGG - Intergenic
923560133 1:235033051-235033073 GCACTTGGGGAGTCCATGGCAGG + Intergenic
923917769 1:238528939-238528961 GCACTTTGAGAGACCAAGGCAGG + Intergenic
924802723 1:247339212-247339234 GCACTTTGAGAGACCAAGGCAGG + Intergenic
924804486 1:247351582-247351604 GCACTATGAGAGGCCAAGGCAGG - Intergenic
1063101808 10:2956655-2956677 GCACTTTGAGAGACCAAGGCGGG + Intergenic
1064018044 10:11787898-11787920 GCACTGGGAGGCAGCAAGGCTGG + Intergenic
1064542154 10:16415776-16415798 GCACTTTGAGGGGCCAAGGCGGG - Intergenic
1064736527 10:18387281-18387303 ACACTATGAGGGAAGATGGCAGG - Intronic
1065286861 10:24194975-24194997 GCACTTGGAAGGAGCATGGAGGG - Intronic
1065587400 10:27233178-27233200 GCACTTTGAGAGGCCATGGCGGG + Intronic
1065919517 10:30380025-30380047 GCACTTTGAGAGTCCATGGCAGG + Intergenic
1066424226 10:35291251-35291273 GCACTATGAGGGGCCAAGGCAGG - Intronic
1067271482 10:44795392-44795414 GAACTAGGAGGTCACATGGCAGG + Intergenic
1069380645 10:67840569-67840591 GCACTTTGAGAGACCAAGGCAGG + Intergenic
1069497273 10:68916930-68916952 GCACTTCGAGAGACCAAGGCAGG - Intronic
1069530013 10:69210700-69210722 GCACTTTGAGAGACCAAGGCAGG + Intergenic
1069548757 10:69347678-69347700 GCACTTTGAGGGGCCAAGGCGGG - Intronic
1071687961 10:87781889-87781911 GCACTTGGAGAGGCCAAGGCAGG - Intronic
1072440775 10:95453037-95453059 GCACTATGAGAGGCCAAGGCAGG + Intronic
1073344948 10:102776008-102776030 GCTCTAGGTGGGTCCAGGGCTGG + Intronic
1075062159 10:119264747-119264769 GCAGTGGGAGGGACCCTGGGTGG + Intronic
1076109412 10:127849459-127849481 GCATGAGGAGGGTCCCTGGCAGG + Intergenic
1076756653 10:132576122-132576144 GCACAGGGAGGGCCCAGGGCTGG - Intronic
1076818024 10:132924177-132924199 GCATCAGGGTGGACCATGGCAGG - Intronic
1076818033 10:132924210-132924232 GCATCAGGGTGGACCATGGCAGG - Intronic
1076989162 11:260820-260842 GGACTAGGAGCCACCATGCCTGG - Intergenic
1077221453 11:1419662-1419684 GCACTTTGGGGGGCCATGGCGGG + Intronic
1077303636 11:1858256-1858278 GCACCAGGAGGGAGCTGGGCTGG + Intronic
1077399772 11:2348739-2348761 GCACTTTGAGGGGCCAAGGCAGG - Intergenic
1077643371 11:3902012-3902034 GCACTTTGGGGGACCAAGGCAGG - Intronic
1078657642 11:13256620-13256642 GCACTTGGAGAGGCCAAGGCGGG + Intergenic
1078996916 11:16711280-16711302 GCACTTGGAGAGGCCAAGGCAGG + Intronic
1079436159 11:20453232-20453254 GCACTCTGAGAGGCCATGGCAGG + Intronic
1080256382 11:30295391-30295413 ACCCTAGGAGGCACCATGGTTGG - Intergenic
1080374035 11:31686632-31686654 GCACTTGGGGAGGCCATGGCAGG + Intronic
1080565396 11:33504712-33504734 GCACTTTGGGGGACCAAGGCAGG - Intergenic
1081913354 11:46715199-46715221 GCACTTTGAGGGGCCAAGGCGGG + Intergenic
1081978198 11:47249110-47249132 GCAGTGGGCGGGACCATGTCTGG + Intronic
1082032939 11:47619692-47619714 GCACTTTGAGAGACCAAGGCAGG + Intronic
1082040454 11:47680530-47680552 GCACTTTGAGAGACCAAGGCAGG + Intronic
1083442579 11:62687031-62687053 GCACTTTGAGAGACCAAGGCGGG + Exonic
1083865358 11:65450765-65450787 GCACTTTGAGGGGCCAAGGCAGG - Intergenic
1083964780 11:66036668-66036690 GCACTTTGAGGGTCCAAGGCAGG + Intergenic
1084034517 11:66500807-66500829 GCACTATGGGAGGCCATGGCGGG + Intronic
1084076453 11:66781782-66781804 GCACTTTGAGGGGCCAAGGCAGG - Intronic
1084220559 11:67674979-67675001 ACCCTAGGAGGGGCCATGGGGGG - Intronic
1084281290 11:68096115-68096137 GCACTTTGGGGGACCACGGCGGG + Intronic
1084293240 11:68190735-68190757 GCACTTTGGGGGGCCATGGCAGG + Intronic
1084402791 11:68955070-68955092 GCACCAGGTGGGACCAGGACAGG - Intergenic
1084647034 11:70464659-70464681 GGACTAGGAGGGCCCGTGGAGGG + Intergenic
1084863391 11:72037257-72037279 GCACTTTGAGAGACCAAGGCGGG + Intronic
1085258281 11:75189698-75189720 GCACTTTGGGGGACCAAGGCAGG + Intronic
1085375322 11:76055292-76055314 GCACTTTGGGGGACCAAGGCAGG - Intronic
1085620200 11:78032153-78032175 GCACTGGGAGGAAGTATGGCTGG + Intronic
1085796282 11:79542953-79542975 GCTCTGGTAGGCACCATGGCAGG - Intergenic
1088244994 11:107809235-107809257 GCACTATGAGAGGCCAAGGCCGG + Intronic
1088634799 11:111809280-111809302 GCACTTTGGGAGACCATGGCAGG + Intronic
1090068122 11:123520522-123520544 GCACTTTGAGAGACCAAGGCGGG + Intergenic
1090203887 11:124874530-124874552 AGACTAGAAGGGACCATGGAGGG + Intronic
1090860719 11:130650217-130650239 GCACTTGGAGGGCTCATGCCGGG - Intergenic
1090887055 11:130886778-130886800 ACACAAGAAGGGGCCATGGCAGG - Intronic
1093452784 12:19334732-19334754 GCACTATGAGAGGCCAAGGCTGG + Intronic
1094069582 12:26398018-26398040 GCACTAGGAGAGATGATGACAGG + Intronic
1094737688 12:33253756-33253778 GCAGAAGAAGGGACCAAGGCAGG + Intergenic
1095446898 12:42291428-42291450 GCACTTCGAGAGACCAAGGCGGG + Intronic
1095759560 12:45814401-45814423 GCACTTTGAGAGACCAAGGCTGG + Intronic
1097181346 12:57173744-57173766 GCACTATGAGGGCCCAGGCCCGG - Intronic
1097227162 12:57484393-57484415 TAACTAGGAGGTACGATGGCAGG + Intronic
1097786629 12:63767256-63767278 GCACTATGAGAGGCCAAGGCAGG + Intergenic
1100120861 12:91367992-91368014 GCACTTTGAGAGACCAAGGCAGG - Intergenic
1100871598 12:98915597-98915619 GCACTATGAGAGGCCAAGGCAGG - Intronic
1101478222 12:105071838-105071860 GCACTTTGAGAGACCAAGGCAGG + Intronic
1101780599 12:107831809-107831831 GCAGTAGGTGAGAGCATGGCAGG - Intergenic
1102066729 12:109982890-109982912 GCACTTTGAGGGTCCAAGGCGGG - Intronic
1102151871 12:110694306-110694328 GCACTTTGAGAGACCAAGGCGGG - Intronic
1102359076 12:112268067-112268089 GCACTTTGAGGGGCCATGGCAGG - Intronic
1102601523 12:114034863-114034885 GAACTAAGAGTGACCATGGGTGG - Intergenic
1102813950 12:115847309-115847331 GCACTTTGAGAGACCAAGGCAGG - Intergenic
1102909594 12:116702664-116702686 GCACTTTGAGGGGCCAAGGCGGG - Intergenic
1102975368 12:117203224-117203246 GCACTTTGAGGGGCCAAGGCAGG - Intergenic
1103113099 12:118299754-118299776 GCACTATGGGAGACCAAGGCAGG - Intronic
1103279804 12:119747915-119747937 GCACTTTGAGAGACCAAGGCAGG + Intronic
1103359417 12:120345103-120345125 GCACTTTGGGGGACCAGGGCAGG + Intronic
1103610370 12:122120470-122120492 GCACTTTGAGGGGCCAAGGCAGG - Intronic
1103750386 12:123154906-123154928 GCACTTTGAGGGGCCAAGGCAGG + Exonic
1103825003 12:123730950-123730972 GCACTTTGAGAGACCAAGGCAGG - Intronic
1103827188 12:123749041-123749063 GCACTTTGAGAGACCAAGGCTGG + Intronic
1103857465 12:123982906-123982928 GCACTTTGAGGGGCCAAGGCAGG + Intronic
1104242242 12:127001330-127001352 GCACTTTGAGGGACCGAGGCGGG + Intergenic
1104699194 12:130888701-130888723 GCACTTTGAGGGGCCAAGGCAGG - Intergenic
1105241434 13:18612181-18612203 GCTGTAGGAGGTACCATGTCAGG + Intergenic
1105805598 13:23950236-23950258 GCACTAGGAGGGAGGCTGGGAGG - Intergenic
1106701664 13:32235375-32235397 GCACTTTGAGAGGCCATGGCGGG + Intronic
1106767008 13:32923223-32923245 GCACTTGGAGGGGCCGAGGCAGG + Intergenic
1107018669 13:35730008-35730030 GCTCTGGGAGGGGCCATTGCTGG - Intergenic
1108358045 13:49644625-49644647 GCACTTTGAGAGACCAAGGCAGG - Intergenic
1108383136 13:49873230-49873252 GCACTTTGAGGGGCCAAGGCAGG - Intergenic
1108634333 13:52317551-52317573 GCACTTGGGGAGACCAAGGCGGG - Intergenic
1109989755 13:70039328-70039350 GCACTTTGAGAGGCCATGGCAGG - Intronic
1110058840 13:71015377-71015399 AAAATAGGAGTGACCATGGCTGG + Intergenic
1111258254 13:85700556-85700578 GCACTTTGAGAGACCAAGGCGGG - Intergenic
1112449717 13:99497756-99497778 GCACTGGGGGAGACCAAGGCAGG + Intergenic
1114481944 14:23041508-23041530 GCACTTTGAGAGACCAAGGCAGG - Intergenic
1114943700 14:27650421-27650443 GCACTATTATGGACTATGGCAGG + Intergenic
1115282099 14:31675647-31675669 GTACTAGGAGGGAACATGAGAGG - Intronic
1115323485 14:32111153-32111175 GCACTTTGGGGGACCAAGGCAGG + Intronic
1115871288 14:37805944-37805966 GCACTTTGAGAGACCAAGGCGGG - Intronic
1115946083 14:38662392-38662414 GCAATCAGAGGCACCATGGCTGG + Intergenic
1116438827 14:44926752-44926774 GCACTTGGAGAGGCCAAGGCGGG - Exonic
1116993975 14:51303476-51303498 GCACTTTGGGAGACCATGGCAGG + Intergenic
1117444080 14:55787149-55787171 GCCCTCAGAGGGACCATAGCTGG - Intergenic
1117657121 14:57966761-57966783 GCACTTTGGGGGACCAAGGCAGG + Intronic
1117939016 14:60940661-60940683 GCACTTTGGGGGACCAAGGCGGG - Intronic
1118477365 14:66130444-66130466 GCACTTGCAGGGAGCAAGGCTGG + Intergenic
1118893442 14:69927432-69927454 GCACTTTGAGGGGCCAAGGCGGG + Intronic
1119346876 14:73932868-73932890 GCACTTTGAGGGGCCAAGGCAGG - Exonic
1121025340 14:90611580-90611602 GGACTGGGAGAGAACATGGCAGG + Intronic
1121253270 14:92514570-92514592 GCACTAGGCTCGACCAGGGCCGG - Intronic
1121765517 14:96482149-96482171 GCACTATGAGAGGCCAAGGCAGG + Intronic
1122488738 14:102098706-102098728 GCACTTTGGGGGACCAAGGCAGG - Intronic
1122948494 14:105026481-105026503 GCACTTTGAGAGACCAAGGCAGG + Intergenic
1123752782 15:23371428-23371450 GCACTATGGGAGACCAAGGCAGG - Intergenic
1123771277 15:23531846-23531868 GCACTATGGGAGACCAAGGCGGG - Intergenic
1123838917 15:24226103-24226125 GCACTTTGGGAGACCATGGCGGG + Intergenic
1123988600 15:25666651-25666673 GCACTTTGAGAGACCAAGGCGGG - Intergenic
1124349316 15:28943769-28943791 GCCCAAGGAGGGGCCAGGGCTGG - Intronic
1126971940 15:54125215-54125237 GCACTTTGAGAGGCCATGGCAGG + Intronic
1127246782 15:57185637-57185659 GCACTTTGAGAGACCAAGGCAGG + Intronic
1127308343 15:57729459-57729481 GCCCTGGGAGGCACCATGGCAGG + Intronic
1127706027 15:61548039-61548061 GCACTTTGAGAGACCAAGGCAGG + Intergenic
1128265450 15:66262488-66262510 GCACTTTGAGGGGCCAAGGCAGG + Intergenic
1128545592 15:68565684-68565706 GCTCTAGGAGGGCCACTGGCTGG + Intergenic
1128556101 15:68632836-68632858 GCACTTAGGGGGACCAAGGCGGG - Intronic
1129349031 15:74943559-74943581 GCAATTTGAGGGACCAAGGCAGG - Intergenic
1130506313 15:84546136-84546158 GCACTATGGGAGGCCATGGCGGG - Intergenic
1132656065 16:1042370-1042392 GCACCAGGATGGGCCATGGTGGG + Intergenic
1132672129 16:1106313-1106335 GGACTGGGGGGGACCCTGGCTGG - Intergenic
1132749596 16:1451448-1451470 GCACTTGGAGAGACCAAGGCAGG - Intronic
1133225546 16:4338743-4338765 CCACTCAGAGGGACCCTGGCAGG + Exonic
1133279066 16:4655031-4655053 GCATTTGGAGTGACCAGGGCAGG + Intronic
1133641067 16:7717948-7717970 GCACTTGGGGAGACCAAGGCGGG - Intergenic
1133930943 16:10231673-10231695 GCACTTTGGGAGACCATGGCAGG - Intergenic
1135117229 16:19734126-19734148 GCACTTTGAGAGACCAAGGCAGG + Intronic
1135134997 16:19880919-19880941 ACACTCGGAGGGGACATGGCTGG - Intronic
1135352094 16:21737762-21737784 GCACTATGGGAGACCAAGGCAGG - Intronic
1135450584 16:22553885-22553907 GCACTATGGGAGACCAAGGCAGG - Intergenic
1135737054 16:24940168-24940190 GCACTTTGAGAGACCAAGGCAGG - Intronic
1136125086 16:28173494-28173516 GCACTTTGAGAGGCCATGGCAGG + Intronic
1136147190 16:28322425-28322447 ACCCCAGGAGGGACCCTGGCAGG - Exonic
1136425032 16:30164287-30164309 GCACTTTGAGGGGCCAAGGCAGG - Intergenic
1137475382 16:48803643-48803665 CCACTAGAAGGCACCAGGGCAGG - Intergenic
1137790195 16:51168603-51168625 GCACTTTGGGGGACCAAGGCGGG - Intergenic
1139266130 16:65640190-65640212 GCACTATGAGAGGCCAAGGCAGG - Intergenic
1140416316 16:74776047-74776069 GCACTATGGGAGGCCATGGCAGG - Intergenic
1140655540 16:77135653-77135675 GCACTTTGAGGGGCCAAGGCAGG + Intergenic
1140670949 16:77278376-77278398 GCACTTTGAGAGACCAAGGCAGG + Intronic
1140804981 16:78525110-78525132 GCACTTGGAGAGACCAAGGCAGG - Intronic
1140847146 16:78901733-78901755 GCACTTTGGGAGACCATGGCAGG - Intronic
1141074802 16:80994897-80994919 GCACTTTGGGGGGCCATGGCAGG + Intronic
1141093456 16:81146462-81146484 CCACTAGGAAGAACCATGTCTGG - Intergenic
1142657501 17:1403645-1403667 GCACTTTGAGGGGCCAAGGCAGG + Intergenic
1142815398 17:2421105-2421127 GCACTTTGGGGGGCCATGGCAGG + Intronic
1143379950 17:6489757-6489779 GCACTTTGGGGGACCAAGGCAGG + Intronic
1144970382 17:19105373-19105395 GCACTTTGAGAGACCAAGGCGGG - Intergenic
1144990687 17:19231535-19231557 GCACTTTGAGAGACCAAGGCGGG - Intronic
1145297414 17:21602231-21602253 GGACTAGGAGGGTCCCTGTCTGG - Intergenic
1146381558 17:32333055-32333077 GCACTTTGGGAGACCATGGCAGG - Intronic
1147208246 17:38854498-38854520 GCACTTTGAGGGACCAAGGCGGG - Intergenic
1147537568 17:41330814-41330836 GCACTTTGAGAGACCATGCCGGG + Intergenic
1147592672 17:41694886-41694908 GCACTTTGAGAGACCAAGGCAGG + Intergenic
1147854303 17:43467142-43467164 GCACTTGAGGGGACCAAGGCTGG + Intergenic
1147956716 17:44139843-44139865 GCACTTTGGGGGACCAAGGCAGG - Intergenic
1150015745 17:61554824-61554846 GCACTTGGGGAGACCAAGGCAGG - Intergenic
1150022831 17:61637455-61637477 GCACTTTGAGAGGCCATGGCGGG + Intergenic
1151274292 17:73022346-73022368 GCACTTTGAGGGGCCAAGGCGGG + Intronic
1151652231 17:75477103-75477125 GCACAAGGAAGGACCATGTGGGG + Intronic
1151864276 17:76789825-76789847 CCAATATGAGTGACCATGGCTGG - Intergenic
1152035734 17:77871457-77871479 ACAAAAGGAGGGCCCATGGCTGG + Intergenic
1153791774 18:8585745-8585767 GCACTTTGGGGGCCCATGGCAGG + Intergenic
1153843381 18:9027032-9027054 GCACTTTGAGAGACCAAGGCGGG + Intergenic
1153922856 18:9806557-9806579 GCCCAAGAAGGGACCAGGGCGGG + Intronic
1154447525 18:14447725-14447747 GCTGTAGGAGGTACCATGTCAGG - Intergenic
1154989123 18:21583395-21583417 GCACTTTGAGGGGCCAAGGCGGG + Intronic
1156338125 18:36187525-36187547 GGACTAGCCGGGGCCATGGCCGG + Exonic
1157198942 18:45642720-45642742 TGAATAGGAGGGACCTTGGCAGG + Intronic
1159176520 18:64842650-64842672 GCACTTCGAGAGTCCATGGCGGG - Intergenic
1159898178 18:74016907-74016929 GCACCAGGAGGGAACAAGACGGG + Intergenic
1160174130 18:76579253-76579275 CCACTTGGAGGGCGCATGGCCGG - Intergenic
1160409338 18:78664670-78664692 GCACTTTGAGAGACCAAGGCAGG + Intergenic
1160989577 19:1855086-1855108 GCCCCAGGCGGGACCCTGGCAGG + Intronic
1161083145 19:2321405-2321427 CCCCCAGGAGGGACCATGGCTGG + Intronic
1161150718 19:2707206-2707228 GCACCAGGAGGGATCCTCGCAGG - Intergenic
1161325372 19:3661141-3661163 GCACTAGGAGGGACCATGGCGGG - Intronic
1161544597 19:4872669-4872691 GCACTTTGAGGGGCCAAGGCGGG - Intergenic
1161581620 19:5083796-5083818 GCACTGGGAGGGACGATGGGAGG - Intronic
1161722028 19:5908368-5908390 GCACTTTGAGAGGCCATGGCGGG + Intronic
1163111744 19:15165534-15165556 GCAGCAGGAGGGGTCATGGCAGG + Intronic
1163477406 19:17534400-17534422 GCACTTTGGGGGACCAAGGCAGG + Intronic
1163683900 19:18699887-18699909 GGCCTAGGAGGGGCCAGGGCAGG + Intronic
1163776085 19:19218716-19218738 GCACTTTGAGAGACCAAGGCGGG - Intronic
1164158007 19:22608119-22608141 GCCCTTGGAGGAACCACGGCTGG + Intergenic
1164407232 19:27961372-27961394 GCACTTTGAGAGACCAAGGCAGG - Intergenic
1165237426 19:34433711-34433733 GCACTTTGAGAGACCAAGGCAGG + Intronic
1165503175 19:36206360-36206382 GCACTTTGAGGGACCAAGGCAGG + Intronic
1165783200 19:38445740-38445762 GCACTTTGAGGGGCCAAGGCGGG + Intronic
1165891166 19:39113175-39113197 GCACTTTGAGAGACCAAGGCAGG - Intergenic
1166018749 19:40005264-40005286 GCACTTTGAGAGACCAAGGCGGG - Intronic
1166660923 19:44647048-44647070 GCACTAGTTGGGGCCATGGCAGG - Intronic
1167272827 19:48515987-48516009 GCACTATGGGAGACCAAGGCGGG - Intergenic
1167623923 19:50574454-50574476 GCACTTGGAGTGGCCAAGGCAGG - Intergenic
1167745431 19:51348167-51348189 GCACTTTGAGGGGCCAAGGCGGG + Intronic
1168144040 19:54409312-54409334 GCACTTTGAGAGACCAAGGCGGG - Intergenic
1168454393 19:56494996-56495018 GCACTAGGAGCAACAGTGGCAGG - Intergenic
925021630 2:574122-574144 GCATTTGGAGGGTCCATGGGTGG - Intergenic
925275944 2:2648454-2648476 GCACTATGGGAGACCAAGGCAGG + Intergenic
925414222 2:3658022-3658044 GGACCAGCAGGGACCATGTCTGG + Intergenic
925424141 2:3734801-3734823 GCACAAGGAAGGACAAAGGCAGG + Intronic
926115179 2:10208761-10208783 ACATCAGGAGGGGCCATGGCTGG - Intronic
926375623 2:12224434-12224456 GACCTAGGAGGGGCCATGGTAGG + Intergenic
926604478 2:14883722-14883744 GCACTTTGGGGGACCAAGGCAGG + Intergenic
927121218 2:19965167-19965189 GCACTTTGAGAGACCAAGGCGGG - Intronic
927136130 2:20097762-20097784 GCACTGGGAGGGTCCCTGGCTGG - Intergenic
927549536 2:23985747-23985769 GCACTTTGAGGGGCCAAGGCAGG + Intronic
928364428 2:30690395-30690417 GCCCTAGGAGGGAGCAGGGCAGG + Intergenic
928735924 2:34289082-34289104 GCACTTTGAGAGACCAAGGCAGG + Intergenic
929771688 2:44897700-44897722 GCACTTGCAGGGACAATGGCTGG - Intergenic
929812897 2:45206631-45206653 GCAGAAGGAGAGACAATGGCAGG + Intergenic
931733512 2:65174205-65174227 GCACTTTGAGGGGCCAAGGCGGG - Intergenic
932298309 2:70644951-70644973 GCACTTTGAGAGACCAAGGCAGG - Intronic
932716809 2:74106507-74106529 GCACTGGCTGGGACCATGGTGGG + Exonic
933637608 2:84724712-84724734 CCACAAGGAGAGGCCATGGCAGG - Intronic
933789696 2:85873744-85873766 GCCCCAGGAGGGACCTTAGCTGG + Intronic
933857264 2:86427999-86428021 GCACTTTGAGGGTCCAAGGCAGG + Intergenic
936603970 2:113929385-113929407 GCACTTTGAGAGGCCATGGCGGG - Intronic
937693845 2:124785987-124786009 GCACTTGGAGAGGCCAAGGCAGG + Intronic
939490373 2:142869095-142869117 GCACTTTGAGGGGCCAAGGCAGG + Intergenic
939902663 2:147868877-147868899 GCACTTTGAGGGACCAAGACAGG - Intronic
940908965 2:159193765-159193787 GCACTTTGAGAGGCCATGGCGGG - Intronic
941938666 2:171009551-171009573 GCACTTGGTGGGGCCAAGGCAGG - Intronic
941999238 2:171629540-171629562 GCACTTTGGGGGACCAAGGCAGG + Intergenic
942177502 2:173348281-173348303 GCACTTTGAGGGGCCAGGGCAGG + Intergenic
942758834 2:179374067-179374089 GCACTATGGGAGACCAAGGCAGG - Intergenic
943661895 2:190567891-190567913 GCACTTTGGGGGACCAAGGCGGG - Intergenic
944715469 2:202373024-202373046 GCACTTTGGGGGACCAAGGCAGG - Intergenic
945280279 2:208029360-208029382 GCACTATGGGAGACCAAGGCGGG - Intergenic
945284650 2:208070295-208070317 GCACTTTGAGAGACCAAGGCGGG + Intergenic
945525543 2:210884234-210884256 GCACTTTGAGGGGCCAAGGCAGG + Intergenic
945793096 2:214330018-214330040 GCACTTTGGGGGGCCATGGCAGG + Intronic
946210185 2:218141417-218141439 GCACTTTGAGAGACCAAGGCAGG + Intergenic
946294593 2:218773770-218773792 GCACTTTGAGAGACCAAGGCGGG - Intergenic
946394693 2:219437299-219437321 CCACTTTGAGGGACCAAGGCAGG - Intronic
946556667 2:220866212-220866234 GCACTGGGAGCCACCATGCCTGG - Intergenic
946588801 2:221220301-221220323 GCACTTTGGGGGACCAAGGCAGG - Intergenic
946929806 2:224660505-224660527 GCACTTTGAGGGGCCAAGGCGGG - Intergenic
947160105 2:227206317-227206339 GCACTACGGGAGACCAAGGCAGG - Intronic
948009517 2:234640057-234640079 GCACTTTGAGAGGCCATGGCGGG - Intergenic
948202338 2:236138253-236138275 GCACTAGGGGAGGCCAAGGCAGG - Intergenic
948799523 2:240425456-240425478 GCACTTTGAGAGACCAAGGCAGG + Intergenic
948906588 2:240982529-240982551 GCAGTAGGAGCCACCAAGGCTGG + Intronic
948931239 2:241133680-241133702 GCATTAGGAAGGACCCTGGGAGG + Intronic
1170526168 20:17240096-17240118 GCACTTTGAGAGACCAAGGCAGG - Intronic
1170958566 20:21003977-21003999 GCACTATGAGGGAACAGGGAGGG + Intergenic
1171421732 20:25022108-25022130 GCACTTGGAGAGGCCAAGGCGGG + Intronic
1171476285 20:25411550-25411572 GCACTTTGGGAGACCATGGCAGG + Intronic
1172404778 20:34679899-34679921 GCACTTTGAGAGGCCATGGCGGG + Intergenic
1172527857 20:35611322-35611344 GCACAAGAAGGGACCATGACTGG - Intergenic
1172856037 20:38003207-38003229 GCACTATGAGAGGCCACGGCAGG - Intronic
1173019519 20:39255424-39255446 GCACTTTGAGAGACCAAGGCAGG - Intergenic
1173292128 20:41724342-41724364 GCACTTTGGGAGACCATGGCAGG - Intergenic
1173710162 20:45148530-45148552 GCACTTTGGGGGACCAAGGCAGG - Intergenic
1173794112 20:45846959-45846981 GCACTTTGAGAGACCAAGGCAGG + Intronic
1174010002 20:47442084-47442106 GCACTTGGGGAGGCCATGGCTGG - Intergenic
1174021157 20:47530709-47530731 GCACTTTGAGAGACCAAGGCAGG - Intronic
1174108995 20:48184757-48184779 GCATTAGTAGGGGCCATGGTTGG + Intergenic
1175123703 20:56736165-56736187 GCACTTTGGGGGACCATGGCAGG - Intergenic
1176001506 20:62833647-62833669 GCACTTTGAGAGACCAAGGCGGG - Intronic
1176448675 21:6842941-6842963 GCTGTAGGAGGTACCATGTCAGG + Intergenic
1176826845 21:13707964-13707986 GCTGTAGGAGGTACCATGTCAGG + Intergenic
1178368350 21:32006308-32006330 GCACTTTGAGAGACCAAGGCAGG - Intronic
1179222399 21:39420273-39420295 GCACTATGGGAGACCAAGGCAGG + Intronic
1180678214 22:17603565-17603587 GCACTTTGAGAGACCAAGGCGGG + Intronic
1180723778 22:17929347-17929369 GCACTTGGAGAGACCAGGACAGG - Intronic
1181142576 22:20817487-20817509 GCACTTTGAGAGACCAAGGCAGG + Intronic
1182591094 22:31380641-31380663 GCACTTGGAGGGGCCAAGGTGGG - Intergenic
1183232343 22:36590861-36590883 GAGGTAGGAGGGAGCATGGCAGG - Intronic
1184000617 22:41670596-41670618 GCACTCTGGGGGACCAAGGCGGG + Intergenic
1184350750 22:43942228-43942250 GCTCCAGGAGGGAAGATGGCAGG - Intronic
1184458932 22:44626253-44626275 GCCCTAGGAGGGCCCACAGCTGG + Intergenic
1184748929 22:46473178-46473200 GCACCACGAGGAACCATCGCTGG + Intronic
949949603 3:9218209-9218231 GCTCTAGGAGAGACCACAGCTGG + Intronic
950052299 3:10001749-10001771 GCACTATGAGAGACCGAGGCGGG + Intronic
951014516 3:17715558-17715580 GCACTTTGAGGGACTAAGGCAGG + Intronic
951216916 3:20033705-20033727 GCACTTTGAGGGGCCAAGGCGGG - Intergenic
951539253 3:23766659-23766681 GCACTTTGAGGGGCCAAGGCAGG - Intergenic
951872871 3:27384714-27384736 GCACTGTGGGGGACCAAGGCAGG + Intronic
952092620 3:29907999-29908021 GCACTTGGAGAGGCCAAGGCAGG + Intronic
952329545 3:32351459-32351481 GCACTTTGGGAGACCATGGCAGG + Intronic
953142025 3:40238048-40238070 GCCCCAGCAGGGACCATGGCTGG + Intronic
953226432 3:41025790-41025812 GCACTTTGGGAGACCATGGCAGG + Intergenic
953267228 3:41402902-41402924 GCACTTTGAGGGGCCAAGGCAGG + Intronic
953318503 3:41950633-41950655 GCACTTGGAGAGACCGAGGCAGG - Intronic
957881432 3:86218690-86218712 GCACTTTGAGAGACCAAGGCAGG - Intergenic
959215188 3:103443040-103443062 GCACTTTGGGGGACCAAGGCCGG - Intergenic
961497544 3:127305289-127305311 GCAATAGGGGAGCCCATGGCTGG - Intergenic
964042974 3:152285868-152285890 GCACTTTGAGAGACCAAGGCGGG - Intronic
965619609 3:170629678-170629700 GCACGAGAAGAGACCTTGGCTGG + Intronic
965706738 3:171516171-171516193 GCACTTTGAGGGGCCAAGGCAGG - Intergenic
966866236 3:184260455-184260477 GCACTGGGAGGGAGAATAGCTGG - Intronic
966898019 3:184460326-184460348 GCACTATGAGAGGCCAAGGCGGG - Intronic
967022086 3:185531632-185531654 GCACTATGGGGGACCACCGCAGG + Intronic
967048302 3:185757706-185757728 GCACTTCGAGAGACCATGGGTGG - Intronic
967059691 3:185861132-185861154 GCACTCTGAGAGACCATGGCAGG + Intergenic
968159212 3:196411563-196411585 GCACTTTGAGAGACCAAGGCAGG + Intronic
968336261 3:197916217-197916239 GCACTTTGAGAGACCAAGGCAGG - Intronic
968386647 4:145702-145724 GCACTTGGAGAGGCCAAGGCAGG - Intronic
969373688 4:6749633-6749655 GCAGTGGGAGGGACCCTGGCAGG - Intergenic
969695415 4:8731513-8731535 CCACCAGGAGGCAGCATGGCTGG + Intergenic
970257677 4:14185545-14185567 GCACTATGGGAGACCAAGGCAGG - Intergenic
970297800 4:14649848-14649870 GCACTTTGAGAGACCAAGGCAGG - Intergenic
970325054 4:14915340-14915362 GCATGAGGAGGGACCGAGGCTGG + Intergenic
970455621 4:16220978-16221000 GCACTTGGAGAGGCCAAGGCGGG - Intronic
974184198 4:58425291-58425313 GAACTTGGAGGGAACATGGAGGG - Intergenic
974651834 4:64764117-64764139 GCACTAGGGGAGGCCAAGGCGGG - Intergenic
974670379 4:65022486-65022508 GCACTTTGAGAGACCAAGGCGGG + Intergenic
974910121 4:68107690-68107712 GCACTTTGAGGGGCCAAGGCGGG + Intronic
975124662 4:70768079-70768101 GCACTTGGGGAGACCAAGGCGGG - Intronic
977268233 4:94881709-94881731 GCACTTTGAGAGACCAAGGCGGG - Intronic
977554485 4:98474924-98474946 GCACTTTGAGAGACCAAGGCAGG - Intronic
977939573 4:102844322-102844344 GCACTTAGGGGGACCAAGGCAGG - Intronic
978582690 4:110248073-110248095 GGGCTAGCAGTGACCATGGCTGG + Intergenic
979632637 4:122921357-122921379 GCACTTTGAGGGGCCAAGGCGGG + Intronic
980074802 4:128283905-128283927 GCACTTTGAGAGACCAAGGCGGG - Intronic
980804483 4:137794152-137794174 GCACTTTGAGGGGCCAAGGCAGG + Intergenic
981086875 4:140692771-140692793 GCACTTTGAGGGGCCAAGGCAGG + Intronic
981546628 4:145900654-145900676 GCACTTTGAGGGGCCAAGGCGGG - Intronic
981844003 4:149145629-149145651 GCACAAGGAGGAATCATTGCCGG - Intergenic
981902230 4:149880076-149880098 GCACTAGGAGGGGCAAAGGGAGG + Intergenic
982190306 4:152847377-152847399 GCACTTTGGGGGACCAGGGCAGG - Intronic
982274941 4:153629063-153629085 GCACTAGGCAAAACCATGGCTGG - Intronic
983234405 4:165162927-165162949 GCACTTTGAGAGACCAAGGCAGG - Intronic
985044814 4:185929778-185929800 GCACTTTGAGGGGCCAAGGCAGG - Intronic
985527580 5:415027-415049 GCACGGGGTGGGGCCATGGCCGG + Intronic
985666066 5:1182010-1182032 ACACTTGGAGGGACCAGGTCGGG - Intergenic
987234425 5:15928521-15928543 GCACCAGGAGGGCCCATAGCTGG - Intronic
988413123 5:30912159-30912181 GCACTTGGGGAGGCCATGGCTGG - Intergenic
988869578 5:35373975-35373997 GCACTTTGAGGGGCCAAGGCAGG + Intergenic
989059456 5:37396043-37396065 GCACTTTCAGGGACCAAGGCAGG - Intronic
990331129 5:54726588-54726610 GCACTTTGAGAGACCAAGGCAGG + Intergenic
990418028 5:55605430-55605452 GCACTTTGAGGGGCCAAGGCAGG - Intergenic
991708271 5:69381232-69381254 GCACTTTGGGAGACCATGGCGGG + Intronic
992851536 5:80814515-80814537 GCACTTGGAGAGGCCAAGGCGGG - Intronic
993456202 5:88130500-88130522 GACCTGGGAGGGACCATGGGTGG - Intergenic
994203959 5:97011474-97011496 GCACTCTGAGAGACCAAGGCAGG - Intronic
994373601 5:98993952-98993974 GCACTTTGAGGGGCCAAGGCAGG + Intergenic
994754014 5:103772810-103772832 GCAGAAGGAGAGACCAAGGCAGG - Intergenic
995487926 5:112657849-112657871 GCACTTTGAGGGACCAAGGCAGG - Intergenic
997505979 5:134417343-134417365 GCACTTTGAGGGGCCAAGGCAGG + Intergenic
998011665 5:138700081-138700103 GCACTTTGAGAGGCCATGGCAGG + Intronic
998984108 5:147736207-147736229 GCACTTTGAGAGGCCATGGCAGG + Intronic
999324407 5:150634570-150634592 ACACTTGGAGAGACCAAGGCAGG + Intronic
1000836507 5:166161233-166161255 GCACTTTGAGGGGCCAAGGCAGG + Intergenic
1001891233 5:175340901-175340923 GCACTTTGAGGGGCCAAGGCAGG + Intergenic
1001914268 5:175546707-175546729 ACACTAAGAGGCAACATGGCAGG - Intergenic
1002047550 5:176550361-176550383 GCACTGGGAGGGCCCGTGGCGGG + Intronic
1002424940 5:179169444-179169466 GAACTAGGAGGCACTAAGGCTGG - Intronic
1003299782 6:4868602-4868624 GCACTTGGAAGGACCATTGTTGG + Intronic
1003837865 6:10091375-10091397 GCACTTTGAGAGACCAAGGCAGG + Intronic
1004121323 6:12825030-12825052 GCACTTTGAGGGGCCAAGGCAGG + Intronic
1004740232 6:18453031-18453053 GCACTCTGAGGGGCCAAGGCTGG - Intronic
1005190392 6:23215092-23215114 GCACTATGAGAGGCCAAGGCAGG + Intergenic
1006033532 6:31195016-31195038 TCACTAGGAGTGACAATGGCTGG + Intergenic
1006033913 6:31197466-31197488 GCACTTTGGGAGACCATGGCGGG - Intergenic
1006129095 6:31858222-31858244 GCACTTTGAGAGAACATGGCCGG + Intronic
1006293069 6:33155456-33155478 GCACTTTGGGGGACCAAGGCAGG - Intergenic
1006333853 6:33410661-33410683 GGACTTGGAGTGACCATGGGGGG + Intronic
1006392838 6:33768918-33768940 GCACTTGGAGAGGCCAAGGCAGG + Intergenic
1006521160 6:34572049-34572071 GGCCTAGTAGAGACCATGGCTGG + Intergenic
1006694148 6:35916810-35916832 GCACTATGAGAGGCCAAGGCAGG + Intronic
1007497787 6:42272984-42273006 GCAGTGGAAGGGAGCATGGCAGG - Intronic
1009487913 6:64248806-64248828 GCACTTTGGGGGACCAAGGCAGG + Intronic
1009967162 6:70589989-70590011 GCACTTTGAGAGACCAAGGCGGG + Intergenic
1010252718 6:73724846-73724868 GCACTTTGGGGGACCAAGGCAGG - Intronic
1011478149 6:87767794-87767816 GCACTTGGAGAGGCCAAGGCAGG + Intergenic
1013214114 6:108011891-108011913 GCACTTTGAGAGACCAAGGCAGG - Intergenic
1013432144 6:110064681-110064703 GCACTGGGAGGGGCCCTGGGAGG - Intergenic
1013530348 6:111013888-111013910 GCACTTTGAGAGACCAAGGCAGG + Intronic
1014034309 6:116747316-116747338 GCACTTTGAGGGGCCAAGGCAGG - Intergenic
1015193723 6:130501743-130501765 GCAAAAGGAGGGACAAAGGCAGG + Intergenic
1015671518 6:135695940-135695962 GAACTAGGAGGGACCTTTGAAGG + Intergenic
1015855674 6:137622033-137622055 GCACTTTGAGAGACCAAGGCAGG - Intergenic
1016770636 6:147846571-147846593 GCACTTGGAGAGGCCAAGGCAGG + Intergenic
1017424179 6:154303673-154303695 GCACTTTGAGAGACCAAGGCAGG + Intronic
1017588418 6:155952035-155952057 GCACTTTGAGAGACCAAGGCAGG + Intergenic
1018677275 6:166234123-166234145 GCACTTTGGGGGACCAAGGCAGG + Intergenic
1018903880 6:168064175-168064197 GCACTGGGAGGAAGCCTGGCTGG + Intronic
1019695898 7:2446043-2446065 GCACTTCGTGGGACCATTGCCGG + Intergenic
1019919580 7:4154930-4154952 GCCACAGGAGGGAGCATGGCAGG + Intronic
1020192099 7:6008501-6008523 GCACTTTGAGGGGCCAAGGCGGG + Intronic
1020200599 7:6076821-6076843 GCACTTTGAGAGACCAAGGCGGG - Intergenic
1020386896 7:7616435-7616457 GCACTTGGAGAGGCCATGGTGGG + Intergenic
1020618309 7:10487762-10487784 GCAGTAGGAGAGAACATGGCAGG + Intergenic
1021457170 7:20842182-20842204 GCACTTTGAGAGACCAAGGCGGG - Intergenic
1022687510 7:32610398-32610420 GCACTCTGGGGGGCCATGGCAGG + Intergenic
1023718647 7:43071047-43071069 CCAATATGAGTGACCATGGCGGG + Intergenic
1025114020 7:56242561-56242583 GCACTTTGGGAGACCATGGCGGG - Intergenic
1025741604 7:64202026-64202048 GCACTTTGAGGGGCCAAGGCAGG + Intronic
1025776607 7:64566739-64566761 GCACTTTGGGGGACCAAGGCGGG - Intergenic
1026159197 7:67853691-67853713 GCACTTTGGGGGACCAAGGCGGG + Intergenic
1026780087 7:73260387-73260409 GCACTATGAGAGACCAAGGTGGG - Intergenic
1027774830 7:82451087-82451109 GCACTTTGGGGGACCAAGGCAGG - Intergenic
1028260776 7:88661611-88661633 GCACTTTGAGAGACCAAGGCAGG - Intergenic
1029579953 7:101429842-101429864 GCACTTTGAGAGACCAAGGCAGG - Intronic
1029617334 7:101667273-101667295 GCACTATGGGAGACCAAGGCAGG - Intergenic
1030007077 7:105130302-105130324 GCACTATGGGAGACCAGGGCGGG + Intronic
1030286733 7:107834469-107834491 GCACTTTGAGAGACCAAGGCAGG - Intergenic
1032274613 7:130443212-130443234 GCACTTTGAGAGACCAAGGCAGG + Intergenic
1032363262 7:131275675-131275697 GCACTTTGAGAGACCAAGGCAGG - Intronic
1032426792 7:131829295-131829317 GCACTTTGGGGGACCAAGGCGGG - Intergenic
1032511731 7:132478060-132478082 GACCTAGGAAGGGCCATGGCTGG - Intronic
1033146076 7:138871061-138871083 GCACTTGGGGGGGCCAAGGCAGG - Intronic
1034359390 7:150480774-150480796 GCACTTTGAGGGGCCAAGGCGGG - Intergenic
1036455633 8:8904213-8904235 CCAATATGAGTGACCATGGCCGG - Intergenic
1036575299 8:10022348-10022370 GCACTTTGAGGGGCCAAGGCAGG - Intergenic
1036580322 8:10068128-10068150 GCACTTTGAGAGACCAAGGCGGG - Intronic
1036762857 8:11523305-11523327 GCACTTTGAGAGACCAAGGCAGG + Intronic
1037135043 8:15450437-15450459 GCACTTGGGGAGACCAAGGCAGG + Intronic
1037518245 8:19654790-19654812 GCACTTTGAGAGACCAAGGCCGG - Intronic
1037575708 8:20200262-20200284 GCACTTTGAGAGGCCATGGCGGG - Intronic
1038068248 8:23985551-23985573 GCACTTTGGGGGACCAAGGCAGG - Intergenic
1039199349 8:35071400-35071422 GCACTTTGAGAGACCAAGGCAGG + Intergenic
1039480455 8:37869343-37869365 GCACTTTGAGGGGCCAAGGCAGG + Intronic
1039800344 8:40949146-40949168 GGACCAGGTGGGACCCTGGCAGG + Intergenic
1041003246 8:53472311-53472333 GCACTTGGAGAGGCCAAGGCAGG - Intergenic
1041621102 8:59970410-59970432 GCACTAGGAGCAACAGTGGCAGG - Intergenic
1042356604 8:67835375-67835397 GCACTTTGAGAGACCAAGGCGGG + Intergenic
1042371487 8:67996438-67996460 GCACTTTGAGGGGCCAAGGCAGG - Intronic
1044025063 8:87159202-87159224 GCACTAGCAAGGATGATGGCAGG - Intronic
1044188816 8:89288913-89288935 GCACTTTGAGAGGCCATGGCGGG + Intergenic
1044336010 8:90985306-90985328 GCACGAGGCGGGCCCAGGGCGGG + Intergenic
1044457811 8:92409011-92409033 TCTCTAGGAGGCACCATGCCTGG - Intergenic
1045127073 8:99103880-99103902 GCACTTTGAGGGGCCAAGGCAGG - Intronic
1046398728 8:113676061-113676083 GGACAGGGAGGGACCATGGGTGG - Intergenic
1046659297 8:116931975-116931997 GCACTTTGGGGGACCAAGGCAGG - Intergenic
1046706018 8:117452496-117452518 GCACTTTGAGGGGCCAAGGCGGG + Intergenic
1046930952 8:119841236-119841258 GCACTTTGAGAGACCAAGGCAGG - Intronic
1046931696 8:119847909-119847931 GCACTTTGGGGGACCAAGGCGGG - Intronic
1049292122 8:141809564-141809586 GCACAAGAAGGGGCCAAGGCAGG + Intergenic
1049625091 8:143616290-143616312 GAACTGGGTGGGACTATGGCAGG + Intronic
1049647348 8:143741435-143741457 GCAAAAAGAGGCACCATGGCAGG - Intergenic
1049704277 8:144033147-144033169 GCACTTTGAGAGACCGTGGCAGG + Intronic
1051626049 9:19101272-19101294 GCACTTGGAGTGGCCAAGGCGGG + Intronic
1052888829 9:33676989-33677011 GCACATGGAGGGACCCGGGCCGG - Intergenic
1053371776 9:37567670-37567692 GAACTAGGAGGCACCATGCCTGG + Intronic
1053403961 9:37854352-37854374 GCACTTTGAGAGACCAAGGCAGG - Intronic
1055164168 9:73171144-73171166 GCACTTTGAGAGGCCATGGCGGG - Intergenic
1055504858 9:76937693-76937715 GCACTTCGAGAGACCAAGGCAGG + Intergenic
1055688324 9:78802216-78802238 GCACTTTGAGAGACCAAGGCAGG - Intergenic
1056007494 9:82287578-82287600 GCACTATGGGAGGCCATGGCAGG + Intergenic
1056202331 9:84288791-84288813 GCACTTTGAGGGACCAAGGCAGG - Intronic
1057043186 9:91862409-91862431 GCACTTTGAGGGACCAAGGCAGG + Intronic
1057043277 9:91863270-91863292 GCACTTCGGGGGACCAAGGCGGG - Intronic
1057787898 9:98101665-98101687 GCACTTTGGGGGACCAAGGCAGG - Intronic
1059049765 9:110911298-110911320 GCACTTTGAGAGACCAAGGCAGG + Intronic
1059423928 9:114209270-114209292 GGCCTAGGAGGAGCCATGGCAGG + Intronic
1059868566 9:118545383-118545405 GCTCTAGGAGGGACCACAGTTGG - Intergenic
1060464940 9:123895372-123895394 GCACTATGAGAGGCCAAGGCGGG + Intronic
1060695953 9:125709104-125709126 GCACTTTGAGAGACCAAGGCAGG + Intergenic
1060722111 9:125986356-125986378 GCAGAAGGAAGGCCCATGGCAGG - Intergenic
1060888999 9:127176410-127176432 GGACGAGGAGGGAGCAGGGCAGG + Intronic
1061198801 9:129124288-129124310 GCACTTCGAGAGACCAAGGCAGG - Intronic
1061478746 9:130885964-130885986 GCACTAGGTGGGAGCGGGGCTGG - Intronic
1062176020 9:135163473-135163495 GCACTTGGAGAGACCAAGGTGGG - Intergenic
1062429990 9:136522740-136522762 GCCCTGGGAGGGCCCATGGCGGG - Intronic
1062594564 9:137293220-137293242 GGACTACCAGGGAACATGGCGGG + Intergenic
1203520514 Un_GL000213v1:41576-41598 GCTGTAGGAGGTACCATGTCAGG - Intergenic
1185579061 X:1196565-1196587 GCACTTGGGGAGACCAAGGCAGG - Intronic
1185881440 X:3744775-3744797 GCACTTTGAGGGACCAAGGTGGG + Intergenic
1185993210 X:4914868-4914890 GCACTTGGAGAGGCCAAGGCAGG + Intergenic
1186532279 X:10309583-10309605 GGATTAGGAGACACCATGGCTGG - Intergenic
1186966277 X:14789367-14789389 GCACTTTGAGGGGCCAAGGCAGG + Intergenic
1187199787 X:17123903-17123925 GCAGTAGGAGGAACTATGCCTGG + Intronic
1187240587 X:17509471-17509493 GCACTTTGGGGGACCAAGGCAGG - Intronic
1188279922 X:28254708-28254730 GCACTAGGAAGGGCCATTGTAGG + Intergenic
1189476787 X:41362333-41362355 GCACTTTGAGGGGCCAAGGCGGG - Intronic
1189616951 X:42793973-42793995 GCACTTTGAGAGACCAAGGCAGG + Intergenic
1190362088 X:49659011-49659033 GCACTTGGGGAGACCAAGGCGGG - Intergenic
1193276160 X:79590399-79590421 CCCCTAGGAGGCACCCTGGCTGG + Intergenic
1193790407 X:85809306-85809328 GCACTATGAGAGACCAAAGCAGG + Intergenic
1195033055 X:100945363-100945385 GCACTTGGGGAGACCAAGGCAGG - Intergenic
1195051900 X:101104612-101104634 GCACTTTGAGGGGCCAAGGCAGG + Intronic
1195350731 X:103994246-103994268 GCACTTCGAGGGGCCAAGGCAGG - Intergenic
1195668936 X:107452994-107453016 GCCCTTGGAGGGAGCATGGGTGG + Intergenic
1196813254 X:119645152-119645174 GCACTTTGAGAGACCAAGGCGGG - Intronic
1197799889 X:130338182-130338204 GCACTTTGAGGGGCCAAGGCGGG + Intergenic
1198338657 X:135692669-135692691 GCACCAGGTGCCACCATGGCTGG + Intergenic
1198391619 X:136180987-136181009 GCACTTTGGGGGACCAAGGCGGG - Intronic
1198585516 X:138116396-138116418 GCACTATGGGGGAGCAAGGCGGG - Intergenic
1201375563 Y:13315360-13315382 GCACTCTGGGGGACCAAGGCAGG + Intronic
1201682843 Y:16667746-16667768 GCACTCGGAGAGGCCAAGGCAGG - Intergenic
1202363663 Y:24138464-24138486 GCACTATGGGAGGCCATGGCAGG + Intergenic
1202507117 Y:25531653-25531675 GCACTATGGGAGGCCATGGCAGG - Intergenic