ID: 1161326667

View in Genome Browser
Species Human (GRCh38)
Location 19:3667561-3667583
Sequence TCACCCTGGTTGGCAGCCAC TGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 237
Summary {0: 1, 1: 0, 2: 0, 3: 23, 4: 213}

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1161326662_1161326667 -4 Left 1161326662 19:3667542-3667564 CCACTGGGGCCTGCCATGGTCAC 0: 1
1: 0
2: 1
3: 26
4: 265
Right 1161326667 19:3667561-3667583 TCACCCTGGTTGGCAGCCACTGG 0: 1
1: 0
2: 0
3: 23
4: 213

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1161326667 Original CRISPR TCACCCTGGTTGGCAGCCAC TGG Intronic
900345862 1:2210009-2210031 TCACCCTGGAATGCAGCCTCAGG + Intronic
903119758 1:21207948-21207970 TCACCCTGGTAAATAGCCACAGG - Intergenic
905016605 1:34782321-34782343 GCACCCTGGTGGGCAGCCATGGG + Intronic
905313026 1:37063698-37063720 TGGCCCTGGTTGGCAGCCTCGGG + Intergenic
907040978 1:51259083-51259105 TCATCCTGGTTGAGAACCACTGG - Intronic
907805728 1:57817556-57817578 TCACACTTCTTGGCAGCCAAGGG + Intronic
910736595 1:90465198-90465220 TCACCCTGGTGGAGAGCTACTGG - Intergenic
913066727 1:115262706-115262728 GCACCCTGTTTTCCAGCCACAGG + Intergenic
913203545 1:116515563-116515585 TAAACCAGGTTGGCAGGCACAGG + Intronic
914504416 1:148276253-148276275 TCACCCTGGTTGGCCACCCAAGG + Intergenic
915234950 1:154473762-154473784 TCACCCAGGTTGGAAGGCAGTGG - Intronic
917956160 1:180101006-180101028 TGACCCTGTTTGGCACCTACTGG - Intronic
922109375 1:222542568-222542590 TCACCCAGGTTGGCATGCAGTGG + Intronic
922351427 1:224737424-224737446 GGACCCTGGGTGGCCGCCACGGG + Intronic
922573187 1:226645685-226645707 TGACCCAGGATGGCATCCACTGG - Intronic
924491673 1:244544229-244544251 TTACCCTGGTTAGAGGCCACAGG - Intronic
1063948762 10:11203219-11203241 ACACACTGATTAGCAGCCACTGG - Intronic
1064803211 10:19099803-19099825 TCACCCAGGTTGGCATACAGTGG + Intronic
1068649695 10:59508482-59508504 TCCCTCTGGGTTGCAGCCACAGG + Intergenic
1069841932 10:71345420-71345442 TCTCCCTTGTTCTCAGCCACTGG - Intronic
1070914546 10:80144533-80144555 TGACACTGGGCGGCAGCCACCGG - Intronic
1072739847 10:97902765-97902787 AGACCCTCTTTGGCAGCCACAGG + Intronic
1073269872 10:102253240-102253262 TCAAGCTGGGTGGCAGCCATTGG - Intronic
1074214374 10:111369912-111369934 TCCCCTTGGTTGAGAGCCACTGG + Intergenic
1074270565 10:111949744-111949766 TCACCTTGGGTGGCAGGCACTGG - Intergenic
1075675775 10:124294896-124294918 CCACCCTGCTTGGCTGGCACAGG + Intergenic
1076277054 10:129209731-129209753 CCACCCTGGTTGAGAACCACTGG - Intergenic
1077042992 11:532790-532812 TCACCCAGGCAGGCGGCCACAGG - Intronic
1077368670 11:2171598-2171620 CCAGCCTGGCTGGCAGCCCCAGG - Intronic
1078367246 11:10716944-10716966 CCACCCCGGTTTCCAGCCACGGG + Intergenic
1079189846 11:18268330-18268352 TCACCCAGGTTGGAGGACACTGG - Intronic
1079288654 11:19165320-19165342 TCATTCTGTTTGGTAGCCACAGG + Intronic
1079357256 11:19740028-19740050 TCCCCCTGGAGGGCAGCCACTGG + Intronic
1081340665 11:41923183-41923205 ACACCATGGTTGGAACCCACTGG + Intergenic
1083985963 11:66215558-66215580 TCACCCAGGCTGGCACGCACTGG - Intronic
1085508797 11:77074877-77074899 TCTTCCTGGTGGCCAGCCACTGG - Intronic
1085629346 11:78100783-78100805 TCACCATGGTGAGAAGCCACTGG - Intergenic
1085782727 11:79424113-79424135 CGTCCCTGGTTGGAAGCCACTGG - Intronic
1089009809 11:115123158-115123180 TCTCCTTGGATGGCAGCTACGGG + Intergenic
1089198463 11:116709251-116709273 TCACCCAGGCTGGCATCCAGTGG + Intergenic
1090156860 11:124447861-124447883 TCACCCTGGTTGGAATGCAGTGG - Intergenic
1090383078 11:126340201-126340223 GCACTCTGGCTGCCAGCCACAGG + Intronic
1090394246 11:126408320-126408342 TCACCCTCATAGCCAGCCACTGG - Exonic
1091619661 12:2076797-2076819 TCACCCTGGTTGGAAGGCCCGGG + Intronic
1092383739 12:8019352-8019374 TTACCCTGGATGGCACCAACGGG - Intergenic
1096345906 12:50846616-50846638 TCACCCAGGTTGGCATGCAGTGG + Intronic
1096522426 12:52191828-52191850 TGACCCCGGTGGGCAGCCCCCGG - Exonic
1097042161 12:56162310-56162332 TCCCCCTGCCTGACAGCCACAGG + Intronic
1097884573 12:64715998-64716020 TCCCTGTGGTTGGCAGCCACTGG + Exonic
1099352723 12:81592793-81592815 TCACCCAGGTTGGAATTCACTGG + Intronic
1101292603 12:103386998-103387020 TCAGCCTGGTAGGAAGGCACTGG - Intronic
1101466099 12:104950768-104950790 GCACCCTGGTTTCCACCCACTGG + Intronic
1101779287 12:107821326-107821348 TCACCCTGGTGGAGAACCACTGG + Intergenic
1101881841 12:108630953-108630975 CCACAGTGGTTGCCAGCCACTGG - Intronic
1103017471 12:117506992-117507014 TCACCCAGGTTGCCAACCACTGG + Intronic
1103070906 12:117941043-117941065 TCACCCAGGTTGGCATGCAGTGG - Intronic
1103182170 12:118922760-118922782 CCATGCTGGTTGGCAGCCTCTGG - Intergenic
1103505338 12:121439230-121439252 ACACCCTGGTTGTCAGGCACCGG + Intronic
1104368092 12:128196021-128196043 TCAACCTGGTTGAAAGCCATGGG - Intergenic
1106654312 13:31725986-31726008 TCACCCTGGTTGGAATGCAGTGG - Intergenic
1111551227 13:89816032-89816054 TCCTCATGGTTGGCAGCCAAAGG - Intergenic
1113275562 13:108725582-108725604 TCAGTCTGGTTGGCAGGAACAGG + Intronic
1114786717 14:25608585-25608607 TCAACCTGGTTGAAAACCACTGG - Intergenic
1115245018 14:31286323-31286345 TCACCCAGGCTGGCATGCACTGG + Intergenic
1117631507 14:57697659-57697681 TCACCCAGGTTGGCATGCAGTGG - Intronic
1120922531 14:89767860-89767882 TCACCCTGATTGAGAACCACTGG - Intergenic
1121397603 14:93640586-93640608 TCACCCTGGTTGGAATGCAGTGG - Intronic
1122113601 14:99517211-99517233 TCACCCTGGCTGGCTCCCACAGG + Intronic
1128393953 15:67204288-67204310 TCACCCTGCTTGGCTGCTAGTGG + Intronic
1132027423 15:98415326-98415348 TCTCCCTGGTTGAGAACCACAGG - Intergenic
1132679513 16:1134002-1134024 TCCACCTGGAAGGCAGCCACGGG + Intergenic
1133639357 16:7701916-7701938 GCACCCTGGTTTGCTGCAACAGG - Intronic
1133837033 16:9376709-9376731 TCACCCTGGCTGGAAGGCAATGG + Intergenic
1134485714 16:14656756-14656778 ACACCCATGTAGGCAGCCACCGG + Intronic
1134537782 16:15040577-15040599 CCTCCCTGCTTGGCAGCCCCAGG - Intronic
1135241564 16:20811195-20811217 TAACCCTGGTTGCCAGGCATGGG - Intronic
1135480016 16:22814449-22814471 GCACCCTGGTCAGCAGCCCCCGG + Exonic
1135777854 16:25272542-25272564 TCACCCAGGTTGGCATGCAGTGG - Intergenic
1135970299 16:27067294-27067316 TCAGCTTGGTGGGCAGCCACCGG + Intergenic
1136508691 16:30722730-30722752 TCACCCTGGTTAGCAGCAAGCGG - Exonic
1137559333 16:49492844-49492866 TCACCCAGGTTGGAAGCACCGGG + Intronic
1137572766 16:49577675-49577697 GAAACCTTGTTGGCAGCCACAGG + Intronic
1137761077 16:50940743-50940765 TCTACCTGGCTGGCATCCACAGG + Intergenic
1138798266 16:59995622-59995644 TCACCCAGGTTGGCATGCAGAGG - Intergenic
1139832268 16:69809726-69809748 TCACCCAGGCTGGCATCCAATGG - Intronic
1140482793 16:75271478-75271500 TCACCCAGGTTGGAAGGCAGTGG + Intergenic
1140520158 16:75574184-75574206 TCACCCTGGATAGCATACACAGG + Intronic
1140811736 16:78585330-78585352 TCACCCTGGCTGCCAGCCCCAGG + Intronic
1141136438 16:81468675-81468697 TCACCCTCGTTTGCGGGCACTGG - Intronic
1142715895 17:1746843-1746865 TCACCCAGCCTGTCAGCCACAGG + Intronic
1143827500 17:9622499-9622521 TCACCCAGGCTGGCATGCACTGG - Intronic
1144038576 17:11388586-11388608 TGACCCTGGTTAGCACACACAGG + Intronic
1146540246 17:33687394-33687416 TCACCCTGGGTAGCAGCCCATGG - Intronic
1147920794 17:43915781-43915803 TGCTTCTGGTTGGCAGCCACAGG - Intergenic
1148533798 17:48420952-48420974 TCACCCCTGTTGGCAACCACTGG + Intronic
1148898774 17:50858972-50858994 TCACCCAGGTTGGAAGGCAGTGG + Intergenic
1151057400 17:71049256-71049278 TTACCCTGGTTGCCAGTGACAGG + Intergenic
1151578633 17:74965067-74965089 TCACCCAGGATGCCCGCCACAGG + Intronic
1151990374 17:77570632-77570654 TCCCCCTGGCTGGAAGCCCCTGG + Intergenic
1152309770 17:79542998-79543020 TGGACCTGGATGGCAGCCACCGG - Intergenic
1153360921 18:4196013-4196035 TCACCCTTCTTAGCACCCACAGG - Intronic
1153622896 18:6996737-6996759 TCACCCAGGTTGGCATGCAGTGG - Intronic
1154341076 18:13502855-13502877 GCAGTCTGGCTGGCAGCCACAGG + Intronic
1155587126 18:27379494-27379516 TCACCCAGGTTGGCGTGCACTGG + Intergenic
1156187041 18:34675299-34675321 TCACCCTGATTGAGAACCACTGG + Intronic
1157309193 18:46539065-46539087 GCTTCCTGGTGGGCAGCCACCGG + Intronic
1157607590 18:48935586-48935608 CCATCCTGGTTCGCAGTCACTGG + Intronic
1158050196 18:53208767-53208789 TCACCCAGGTTGGCATGCAGTGG + Intronic
1161212629 19:3075479-3075501 TCACCCTGGTTGAGACCCCCTGG - Intergenic
1161326667 19:3667561-3667583 TCACCCTGGTTGGCAGCCACTGG + Intronic
1161684358 19:5695692-5695714 TCATTCTGGGTGGGAGCCACAGG + Intronic
1163461073 19:17437956-17437978 TCACCCAGGTTGGAAGGCAGTGG + Intronic
1164427313 19:28153151-28153173 TCACTCTGGATGGCAGGCAGCGG - Intergenic
1165214655 19:34262021-34262043 TCACCCTGGCTGGAAGGCAGTGG + Intronic
1165478586 19:36047475-36047497 CCACCTTGGATGGAAGCCACAGG + Intronic
1165913078 19:39241516-39241538 TCACCCTGGCTGGAGGGCACTGG - Intergenic
1166293216 19:41876744-41876766 TCACACGGGTAGTCAGCCACAGG + Intergenic
1168132348 19:54329644-54329666 GCACCATGGCTGGCAGCCCCAGG - Intergenic
1168169278 19:54575395-54575417 GCGCCCTGGTTGGCAGCCCCAGG + Exonic
925049047 2:796800-796822 TCACCCAGGTTCACAGCCTCAGG - Intergenic
925183575 2:1832253-1832275 TCTTCCTGGTTGGCAGACAGGGG - Intronic
929487738 2:42370003-42370025 TCACCTGAGTTGACAGCCACTGG + Intronic
930514732 2:52392753-52392775 TCAGCATGGTTGGAGGCCACAGG + Intergenic
931571127 2:63670353-63670375 TCTCCATGGTGGGCAGTCACTGG - Intronic
931784297 2:65605453-65605475 TGCCCCTGGTTGAGAGCCACTGG - Intergenic
931811292 2:65857341-65857363 TCACCCAGGCTGGCATGCACTGG - Intergenic
932018149 2:68054076-68054098 TCACCTTGTGTGTCAGCCACTGG - Intronic
933223298 2:79716057-79716079 TCCCCCTGTTAGGAAGCCACAGG + Intronic
935130892 2:100260123-100260145 TCACCCTAGGTGGCAGCCTCAGG + Intergenic
936521142 2:113212831-113212853 ACAGCCTGGCTGGCTGCCACCGG + Intergenic
938223523 2:129594457-129594479 TCACCCTGGCTGGAAGGCAGTGG + Intergenic
938766179 2:134461855-134461877 ACAGCCTGGCTGGCAGCCTCAGG + Intronic
940558981 2:155269522-155269544 TCACCCAGGTTGGAATCCAGAGG - Intergenic
943236164 2:185322539-185322561 TCACCCAGGTTGGAATCCAATGG - Intergenic
945617319 2:212088556-212088578 ACACCCTGGTTGGTAGTCCCTGG + Intronic
946817130 2:223590743-223590765 TCTCCCTGGTTGCCAAACACTGG - Intergenic
947456087 2:230255255-230255277 TCAGCCTTGGTGGCAGCAACTGG + Intronic
947496686 2:230642940-230642962 TCACCCTGCTTGGCAAATACAGG + Intergenic
947905712 2:233760385-233760407 TCCCAGTGGATGGCAGCCACTGG + Exonic
948716029 2:239864453-239864475 TCGCCCTGGATGCCAGCCTCCGG - Intergenic
948805276 2:240451229-240451251 TCTGCCTGGTTGGCATTCACGGG + Intronic
1168803789 20:661449-661471 TGACCCTTGGTGGCAGCTACAGG + Intronic
1171205406 20:23275197-23275219 TCACTCTGCTTTCCAGCCACGGG + Intergenic
1172157292 20:32836742-32836764 TGACCTTGTCTGGCAGCCACAGG - Exonic
1172332207 20:34082995-34083017 TCAACCTGGCTGGCAGCAACAGG - Intronic
1172624173 20:36337853-36337875 TCAGCCTGCTGGGCACCCACAGG + Intronic
1173280831 20:41625912-41625934 TCACCCAGGTTGGCATGCAGTGG - Intergenic
1173797269 20:45870298-45870320 TCACCCAGGTTGGAATGCACTGG - Intronic
1173932000 20:46828451-46828473 GCACACTGCTTGGCAGTCACAGG - Intergenic
1175003394 20:55655118-55655140 TCACCCGGGTTGGCATGCAGTGG - Intergenic
1177151296 21:17457857-17457879 TCACCCAGGTTGAAAACCACTGG + Intergenic
1178239334 21:30881150-30881172 GCCCACTGGTTGGCAGACACTGG + Exonic
1178301545 21:31457759-31457781 TTACCCTGGTTGAGATCCACTGG - Intronic
1180165440 21:46023308-46023330 TCACCCTGGATTGCGGACACTGG - Intergenic
1180676167 22:17587863-17587885 TCACCTTGGGTGGCAGCCCCAGG + Intronic
1181280194 22:21714243-21714265 CCATCCTGGGTGGCCGCCACCGG - Intronic
1182800164 22:33025592-33025614 TCACCCAGGTTGTCACCCAGTGG - Intronic
1183541947 22:38434580-38434602 TCACCCTGGTCCCCAGCCTCTGG + Intronic
951498568 3:23357876-23357898 TCACCCAGGCTGGCATGCACTGG + Intronic
952038547 3:29233911-29233933 TCACCCAGGCTGGCGGACACTGG - Intergenic
954417590 3:50401167-50401189 TCACCGCTGTTGGCAGCAACAGG + Intronic
954682064 3:52351238-52351260 TCAGCCTGGTGGGCAGTCCCTGG + Intronic
955398657 3:58575448-58575470 TCACCCTTGGAGGCAGCCAGTGG + Intronic
956125539 3:66007934-66007956 TCACCCTGGTTGGAATACAGTGG + Intronic
959188093 3:103072810-103072832 TCACCCTGGTTGGAACACAATGG - Intergenic
963002184 3:140692451-140692473 TCATCCTGGTTGCCAGCCCCAGG + Intronic
965493324 3:169366728-169366750 CCTCACTGGTTGGCAGCCACAGG - Intronic
966224003 3:177578578-177578600 TCACCCAGGCTGGCATCCAGTGG - Intergenic
967078358 3:186025659-186025681 TTCCCCTGGTTGACAACCACTGG + Intergenic
968339348 3:197941598-197941620 TCACCCAGGTTGGCATGCAGTGG + Intronic
970422697 4:15920089-15920111 TCACCCTGGTTGGAGGGCAGTGG - Intergenic
971926111 4:33011341-33011363 TGACCTTGTCTGGCAGCCACAGG + Intergenic
972217970 4:36918144-36918166 TCTCCCTGGTTGGCAATGACAGG - Intergenic
974277143 4:59736861-59736883 TCACCATGTTTGTCAGCCAATGG - Intergenic
974875757 4:67701082-67701104 TCCCCCTGATGGGCGGCCACAGG + Exonic
975812830 4:78187434-78187456 TCCCCATAGTTGGCAGCCTCAGG + Intronic
977808771 4:101335171-101335193 ACACCATAGTTGGAAGCCACTGG + Intronic
980797062 4:137698629-137698651 TAACCCTGGTTGAAAACCACCGG + Intergenic
984057531 4:174948584-174948606 GCACTTTGGTTGGCAGCCCCTGG - Intronic
985882870 5:2653753-2653775 TCATCCTGGCTGACAGCCACTGG - Intergenic
986419695 5:7566454-7566476 TCACCCTGGTTGGAGTCCAGTGG - Intronic
991024117 5:62011409-62011431 GCACACTGGTTGGGAACCACTGG - Intergenic
992466670 5:77012892-77012914 TCAAACTGGTTGGCAGGCAGTGG - Intergenic
994512115 5:100717608-100717630 TCAACTTTGTTGGCAGCTACAGG + Intergenic
997518334 5:134506356-134506378 ACACCCTGGCTGGCATTCACCGG - Intergenic
998797265 5:145833795-145833817 TTGCCTTGGTTAGCAGCCACGGG - Intronic
999246489 5:150157774-150157796 TCAGACTGGTTCCCAGCCACGGG + Intergenic
999718786 5:154383087-154383109 TGGCCATGGTTGGCAGTCACTGG + Intronic
1001000314 5:167999778-167999800 TCACCCTTGTGGGCAGACGCTGG + Intronic
1001115070 5:168932609-168932631 GCAGCCTGGTGGGCAGCCAATGG + Intronic
1001449278 5:171811786-171811808 TCACCTTGCTTGGCTTCCACTGG + Intergenic
1006162770 6:32047838-32047860 TCCCGCTGGTTGGCTGCCACCGG + Intronic
1006717968 6:36132130-36132152 TCACCCTGGCTGGAGGCCATAGG - Intronic
1007078829 6:39084721-39084743 TCATCCTGGCAGGCAGCCTCTGG + Intronic
1007123131 6:39400151-39400173 GCACCCTGTTTGGCTGTCACAGG + Intronic
1008618267 6:53246873-53246895 TCACCCCAGTTGGGAACCACTGG + Intergenic
1009388999 6:63122581-63122603 TCACCCAGGTTGGCATACAGTGG - Intergenic
1012329059 6:97961472-97961494 TCACCCTGATTTACAGCCTCTGG - Intergenic
1014343262 6:120234325-120234347 TCACCCTGCTTGGGACCCAGAGG + Intergenic
1017028228 6:150199093-150199115 TCACCATAGTTGGGAGCCACAGG - Intronic
1025698030 7:63790124-63790146 TCGCCCCGCTTGGCAGCCCCTGG - Intergenic
1029162560 7:98563056-98563078 CCACCCAGGTGGGGAGCCACAGG + Intergenic
1029478386 7:100798757-100798779 TCACCTTGGTGGGGAGCCAGAGG - Intergenic
1029595877 7:101537471-101537493 TCACCCGGGTGGGCAGCCATGGG - Intronic
1031847513 7:126824220-126824242 TCACCCAGGCTGTCTGCCACTGG - Intronic
1031980593 7:128121986-128122008 CAACCCTGATTGGCAGCCATGGG + Intergenic
1032438315 7:131920510-131920532 TCACCCTGAGTGAAAGCCACTGG - Intergenic
1034337422 7:150332436-150332458 TCTCACTGGCTGGCAGCCCCAGG + Exonic
1034495727 7:151420956-151420978 TCACCCTGGTTGGAGTGCACTGG + Intergenic
1034596872 7:152204555-152204577 TCACCCAGGTTGGCATGCAGTGG - Intronic
1041050685 8:53931598-53931620 TCAGCCAGTTTGCCAGCCACAGG - Intronic
1043379496 8:79687480-79687502 ACACCCTGGTTGGCATCAATAGG + Intergenic
1044401838 8:91781670-91781692 TCACCCAAGTTGGCAGGCAGAGG - Intergenic
1044707644 8:95024471-95024493 TCGCCCTGTTTGGGAACCACTGG - Intronic
1044959698 8:97518216-97518238 ACAGCCAGGTTGACAGCCACTGG - Intergenic
1046927119 8:119803652-119803674 TCACCCTTGTTGGAATACACTGG - Intronic
1047449548 8:124952604-124952626 TCCCTTTGGTTGACAGCCACTGG + Intergenic
1048568153 8:135625586-135625608 TGACCTTGTCTGGCAGCCACAGG + Intronic
1049212724 8:141394176-141394198 TCTCCCTGGTTGGCAGGTCCTGG + Intronic
1049243480 8:141550224-141550246 TCACCGTGCTTGGCAGATACAGG - Intergenic
1049951578 9:649776-649798 CCTCCCTGGTTGGCTGCCATGGG - Intronic
1050559190 9:6817239-6817261 TCACCCAGGTTGGCATGCAATGG + Intronic
1050774945 9:9248130-9248152 TCACCCAGGTTGGCATGCAGTGG + Intronic
1053484955 9:38445416-38445438 TGAGCCTGTTTGGCAGGCACTGG + Intergenic
1057125766 9:92614873-92614895 TCTCCCTGTTAGGCTGCCACAGG - Exonic
1057947932 9:99345849-99345871 TCACCCTGGATTGTAACCACTGG + Intergenic
1058054202 9:100433407-100433429 TCACCCTGGCTGGCATGCAGTGG + Intronic
1059523850 9:114970137-114970159 TCACCCTGGCTGGCATGCAGTGG - Intergenic
1062639710 9:137512417-137512439 TCACCTCGGCTGGCAGCCATCGG + Intronic
1185951677 X:4442326-4442348 TCACCCAGGCTGGAAGGCACTGG - Intergenic
1186884953 X:13903787-13903809 CCACCCTGGCTGCCAGACACAGG - Intronic
1189783581 X:44539704-44539726 TCACCCAGGTTGGAATGCACTGG + Intronic
1194994742 X:100579784-100579806 TCACCCAGGTTGGAGTCCACTGG + Intergenic
1196848578 X:119916529-119916551 TCACCCTGGCTGGCGGGCAGTGG + Intronic
1196868570 X:120091259-120091281 CCAGCCTAGTTGGCAGCCTCAGG + Intergenic
1198376375 X:136044214-136044236 TCAGTCTGGTTGGCAGACAATGG + Intronic
1201525732 Y:14931952-14931974 TAACCCTGGTTTTCAGCAACAGG + Intergenic