ID: 1161330515

View in Genome Browser
Species Human (GRCh38)
Location 19:3684710-3684732
Sequence ACCACAGACGCACCCAGAGC GGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 162
Summary {0: 1, 1: 0, 2: 1, 3: 13, 4: 147}

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1161330510_1161330515 20 Left 1161330510 19:3684667-3684689 CCTCTCAGTGTGGCAGTGGTTTG 0: 1
1: 0
2: 4
3: 22
4: 235
Right 1161330515 19:3684710-3684732 ACCACAGACGCACCCAGAGCGGG 0: 1
1: 0
2: 1
3: 13
4: 147

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1161330515 Original CRISPR ACCACAGACGCACCCAGAGC GGG Intronic
900146487 1:1161031-1161053 ACCACCGAAGCCCCCAGACCGGG + Intergenic
901069760 1:6511296-6511318 ACCCCAGCAGCACCCAGGGCTGG - Intronic
901588834 1:10321901-10321923 AACCCAGATGCACCCACAGCAGG - Intronic
902644660 1:17790102-17790124 GCCACAGACCCACAGAGAGCTGG - Intronic
903672031 1:25042104-25042126 ACCACAGACTCACAGAAAGCTGG - Intergenic
904263002 1:29301168-29301190 CTCACAGCCTCACCCAGAGCAGG + Intronic
910587043 1:88891532-88891554 ACAACAGACACACCGAAAGCAGG + Exonic
911386743 1:97185358-97185380 ACCAAACACCCACCCACAGCTGG + Intronic
915008656 1:152664254-152664276 ACCACAGCAGCTCCCAGAGCTGG - Exonic
915009940 1:152676164-152676186 ACCACAGCAGCTCCCAGAGCTGG - Exonic
915011100 1:152686992-152687014 ACCACAGCAGCCCCCAGAGATGG - Exonic
915021936 1:152787460-152787482 GCCACAGCTGCCCCCAGAGCTGG - Exonic
915022899 1:152797943-152797965 GCCACAGCCGCCCCCAGAGCTGG - Exonic
915023601 1:152805296-152805318 GCCACAGCTGCCCCCAGAGCTGG + Exonic
920121458 1:203661779-203661801 ACCACAGACACGCCCAGGGCTGG - Intronic
922143100 1:222909928-222909950 ACCACAGCCCCAGGCAGAGCTGG - Intronic
924780401 1:247141941-247141963 AGCACAGAGGCCCCCAGAGCTGG - Intronic
1063019309 10:2111335-2111357 ACCACTGAGGAAACCAGAGCTGG + Intergenic
1063225120 10:4008369-4008391 AGCACACAAGCACACAGAGCAGG - Intergenic
1064815929 10:19262341-19262363 ACCACACACACACACAGAGGAGG - Intronic
1067917697 10:50418382-50418404 ACCTCAGAGGCTCCAAGAGCGGG + Intronic
1073405576 10:103294272-103294294 CACACACACGCACGCAGAGCTGG + Intergenic
1074869358 10:117564833-117564855 CACACAGACTCAGCCAGAGCAGG + Intergenic
1076809970 10:132881392-132881414 CCCACAGAGCCACCCAGAGAGGG - Intronic
1077246909 11:1544096-1544118 ACCACACACCCACCTAGGGCCGG - Intergenic
1080458567 11:32435407-32435429 CCCACCCACCCACCCAGAGCCGG - Exonic
1080701075 11:34644602-34644624 ACCTCAGAAGCACTAAGAGCAGG - Intronic
1081653983 11:44845140-44845162 ACTGAAGACTCACCCAGAGCAGG + Intronic
1083656530 11:64232423-64232445 ACCCCAGCTGCACCCAGACCGGG + Exonic
1083729478 11:64645029-64645051 TCCTCAGAGGCACCCAGAGGAGG + Intronic
1084705709 11:70814976-70814998 ACCCCACACACTCCCAGAGCAGG + Intronic
1084909109 11:72373213-72373235 GGCAGAGACGCAGCCAGAGCAGG - Intronic
1085279343 11:75320037-75320059 ACCAAAGTCCCCCCCAGAGCAGG + Intronic
1085504455 11:77049193-77049215 ACCTCAGACGCATGCAGAGCTGG + Intergenic
1090634558 11:128682574-128682596 ACCACATACACACACACAGCAGG + Intergenic
1092134676 12:6138374-6138396 GCCACAGAAGCACCCAGAGGTGG - Intergenic
1101086269 12:101239536-101239558 ACCCCAGGCTCAGCCAGAGCAGG + Intergenic
1101323105 12:103690793-103690815 ACCACAGACTAACCCAGAAAGGG + Intronic
1104988365 12:132610403-132610425 AGCAGAGAAGTACCCAGAGCAGG + Intronic
1109250677 13:60016485-60016507 CCCACCCACGCACCCAGAGCTGG + Intronic
1116140408 14:40986173-40986195 AACACAAACGCCCCCAGAACTGG - Intergenic
1118349837 14:64965826-64965848 TCCGCAGATGCACCCACAGCTGG - Intronic
1121700193 14:95947046-95947068 ACAACAGACCCACCCACAGGAGG - Intergenic
1123399023 15:19965752-19965774 ACCCAGGACCCACCCAGAGCAGG - Intergenic
1125509646 15:40286127-40286149 AGCACAGAGGCACCAACAGCCGG + Intronic
1126156864 15:45574073-45574095 ACCCCAGACTCAGCCAGAGCAGG - Intergenic
1130663007 15:85845404-85845426 ACCACAGCCACATTCAGAGCCGG - Intergenic
1130908845 15:88257352-88257374 CCCAGAGAAGCACCCAGAGCCGG + Intergenic
1132121576 15:99180481-99180503 TCGACAGACACAGCCAGAGCTGG + Intronic
1132289409 15:100688953-100688975 ACCCCAGACTCTCCCAGGGCAGG + Intergenic
1132939838 16:2501190-2501212 CCCCCAGCCCCACCCAGAGCTGG + Exonic
1134418288 16:14063132-14063154 ACCTCTGCCGCACCCAGTGCTGG - Intergenic
1135341569 16:21652953-21652975 CCCAGAGTGGCACCCAGAGCAGG - Intronic
1137003133 16:35248792-35248814 AACACAGACTCACCCAGGACAGG - Intergenic
1137019396 16:35408602-35408624 AACACAGACTCACCCAGCACAGG - Intergenic
1137699768 16:50489141-50489163 TCCAGAGACTCACCCAGAGTGGG + Intergenic
1138294981 16:55878393-55878415 ACCACACATGGACCCACAGCTGG + Intronic
1138574350 16:57897960-57897982 ACCAGAGAAGCAGCCAGGGCTGG + Intronic
1139397364 16:66650906-66650928 ACCACACGCGCACACACAGCAGG + Intronic
1139477144 16:67208440-67208462 CCCACAGTCACGCCCAGAGCTGG - Exonic
1141311058 16:82913597-82913619 ACCACAGAGGCCAGCAGAGCAGG + Intronic
1141802417 16:86319857-86319879 AAGAAAGACGCAACCAGAGCTGG + Intergenic
1147527331 17:41238302-41238324 ACCACAGCTGGACCCACAGCTGG - Exonic
1147796935 17:43050653-43050675 ACCACGGACGGGCCCAGAGCAGG - Intronic
1148466637 17:47868971-47868993 ACCACACACGGCACCAGAGCCGG + Intergenic
1148744157 17:49909210-49909232 CACACACACGCACCCTGAGCTGG + Intergenic
1151466236 17:74287263-74287285 ACCAGACCCGCCCCCAGAGCAGG - Intronic
1152232148 17:79119222-79119244 ACCACAGATGCCCTCAGATCTGG - Intronic
1152571944 17:81124803-81124825 AGCGCAGAGGCACCCACAGCTGG + Exonic
1154360256 18:13654748-13654770 TCCAGAGACCCACCCAGAGTGGG + Intergenic
1155215873 18:23642413-23642435 GCCACAGCCTCACACAGAGCTGG + Intronic
1156840831 18:41607951-41607973 CCCACACACACACCCAGAGGTGG - Intergenic
1157204492 18:45687140-45687162 ACCACAGACACAGGCAGAGCTGG + Intergenic
1157502642 18:48202237-48202259 ACAACAGACACACGCAGAGAGGG + Intronic
1160288411 18:77568269-77568291 AAGACAGACACTCCCAGAGCAGG - Intergenic
1160474070 18:79166976-79166998 GCCACAGCCTCACACAGAGCCGG - Intronic
1161330515 19:3684710-3684732 ACCACAGACGCACCCAGAGCGGG + Intronic
1161944948 19:7429687-7429709 CCCACAGACGCCCCCCAAGCTGG + Intronic
1162421337 19:10567703-10567725 ACCAAAGACGCCCCCAGATATGG + Intronic
1164762218 19:30736660-30736682 AACACAGAGGCACCCAGAGCAGG - Intergenic
1164938465 19:32232770-32232792 AACACACACACACCCAGATCTGG - Intergenic
1168353002 19:55687222-55687244 ACCACAGTGGCAGCCACAGCTGG - Intronic
925068002 2:944087-944109 GCCCCAGACTCAGCCAGAGCAGG - Intergenic
925150786 2:1613290-1613312 ACCTCAGAAGGACACAGAGCAGG - Intergenic
930981046 2:57526362-57526384 ACAACAAAAACACCCAGAGCTGG - Intergenic
932502802 2:72199109-72199131 AACAGAGTCCCACCCAGAGCTGG + Intronic
932865479 2:75336921-75336943 ACCAAGCACGCACCAAGAGCGGG + Intergenic
938612941 2:132968047-132968069 ACCACAGACCCTCCCTCAGCTGG - Intronic
944676230 2:202035406-202035428 ACCACACGCCCACCCAGAGGCGG - Exonic
945806905 2:214501325-214501347 ATCACAGACTCCACCAGAGCTGG - Intronic
946464241 2:219897248-219897270 GCCACAGAGGAACCCAGGGCAGG + Intergenic
946600198 2:221351344-221351366 ACCAAAGAAGCACCAAGAGGAGG - Intergenic
1170340045 20:15314859-15314881 ACCACATGCACACCCAGTGCAGG + Intronic
1172664744 20:36591266-36591288 ACCACCCACACCCCCAGAGCAGG + Exonic
1175160664 20:57005376-57005398 ACCACACACACAGCCTGAGCAGG + Intergenic
1176200702 20:63859000-63859022 CCCACACACACACACAGAGCAGG - Intergenic
1177516246 21:22154794-22154816 ACCACAGGCTCTGCCAGAGCAGG + Intergenic
1181273722 22:21675701-21675723 ACCACAGCCTCAGCCAGAGGGGG - Intronic
1181570368 22:23764970-23764992 TCCACAGAGACACCCAGAGTGGG + Intronic
1183145653 22:35989094-35989116 AGCACAGATGCACACTGAGCAGG + Intronic
1183659047 22:39207646-39207668 ACCACAGACCCACAGAGAGGGGG + Intergenic
1184339831 22:43880187-43880209 CCAACAGAAGCACCCACAGCTGG + Exonic
1184686969 22:46100633-46100655 GCCACAGCCCCAACCAGAGCCGG + Intronic
1185225566 22:49649905-49649927 GCGACAGACGTACCCAGCGCTGG - Intronic
949599086 3:5579212-5579234 CTCACAGACACACCCGGAGCAGG - Intergenic
949979798 3:9495021-9495043 ACCACACAGTCGCCCAGAGCAGG + Intergenic
950120763 3:10481101-10481123 AACACAGAGGCAAGCAGAGCTGG + Intronic
953487136 3:43311332-43311354 ACCACAGAAGCTCCCCCAGCTGG + Intronic
954373644 3:50183246-50183268 ACCCCAGCCTCACCCAGAGGAGG - Exonic
955922107 3:63968022-63968044 TCCACAGGCTCATCCAGAGCTGG - Intronic
957040020 3:75329430-75329452 ACCACAGAGGCCCTCACAGCTGG + Intergenic
957660137 3:83139372-83139394 ATCACAGACGCATTCATAGCTGG + Intergenic
960849690 3:122039081-122039103 AACACAGAACCACCAAGAGCTGG + Intergenic
968065541 3:195757046-195757068 AACACAGACACACCCAGGACAGG + Intronic
969591546 4:8124877-8124899 ATCGCAGGCACACCCAGAGCAGG - Intronic
973895620 4:55409807-55409829 TCCAAAGACGCACCCAAAGTTGG - Intronic
977410391 4:96654193-96654215 AGCACAGCCTCACACAGAGCTGG + Intergenic
979473374 4:121126650-121126672 ACCACAGCCACACACGGAGCTGG - Intergenic
981802697 4:148676990-148677012 CCCACAGAAGCTCCCAGAGAGGG - Intergenic
999327736 5:150653557-150653579 ACCACAGTGCCACCCTGAGCAGG - Exonic
999327994 5:150655340-150655362 ACCACAGTGTCACCCTGAGCAGG - Intronic
1002173518 5:177388329-177388351 ACCACAGTCTCATCCAGATCTGG + Exonic
1002435997 5:179231214-179231236 ACCATAGAGGCTGCCAGAGCTGG + Intronic
1002914820 6:1520383-1520405 ACCACATACACACACAGAGATGG - Intergenic
1005895149 6:30171770-30171792 ACCACAGATGTTCCTAGAGCAGG - Intronic
1013043658 6:106461801-106461823 GCCACAGCCACACCCACAGCAGG - Intergenic
1016461736 6:144285767-144285789 GCCACCGCCGCACCCCGAGCTGG - Intronic
1018948767 6:168364995-168365017 GCAGCAGAGGCACCCAGAGCAGG + Intergenic
1019217556 6:170453597-170453619 ACCACAGCCAAATCCAGAGCAGG + Intergenic
1026401313 7:70016462-70016484 ACCACAGAGGCAGCCAAAGTGGG - Intronic
1026457271 7:70583602-70583624 AAAACAGAAGCTCCCAGAGCTGG - Intronic
1032151216 7:129431755-129431777 ACCACAGAGGCACCCATACCTGG - Intergenic
1032902316 7:136323745-136323767 ACCACACACACACACAGATCTGG - Intergenic
1033545639 7:142397672-142397694 ACCAGAGAAGACCCCAGAGCAGG - Intergenic
1040290550 8:46121913-46121935 ATCACAGAAGCCCCCAGGGCTGG - Intergenic
1041737688 8:61129127-61129149 ACCACAGTCGCACAAAGAGATGG + Intronic
1043750231 8:83925796-83925818 GCCACAGCCTCACACAGAGCCGG - Intergenic
1048189661 8:132276388-132276410 ACCACAGAAACATCCAGGGCAGG + Intronic
1048323235 8:133418112-133418134 ACCACAGACCACCCCAGTGCTGG - Intergenic
1048978726 8:139691247-139691269 ACCCCAGACACAGCCAGTGCAGG - Intronic
1049202725 8:141349825-141349847 GCCACAGCCCAACCCAGAGCAGG - Intergenic
1049444043 8:142621941-142621963 AGGCCAGACGCCCCCAGAGCTGG + Intergenic
1050377788 9:4991055-4991077 AGCACAAAAGCACCCAGAGATGG - Intronic
1050611742 9:7360759-7360781 ACCAAAGAGGCTCCCAAAGCTGG - Intergenic
1053024789 9:34720517-34720539 ACCACAGAGGAGCCAAGAGCTGG - Intergenic
1053055743 9:34992155-34992177 ACCACAGACACACCGATAGAGGG + Intronic
1053260530 9:36659656-36659678 ACCCCAGATGTACACAGAGCCGG - Intronic
1056174983 9:84025708-84025730 ACCACAGGCACACCCACACCTGG - Intergenic
1057255566 9:93544363-93544385 ACCACACCAGCACCCAGACCTGG - Intronic
1059034837 9:110743034-110743056 AACAAAGACGAACGCAGAGCTGG + Intronic
1060485140 9:124041760-124041782 ATCACAGACGCACTCACAGTCGG - Intergenic
1061872237 9:133527231-133527253 ACCAGAGCCGCACACACAGCAGG - Intronic
1061929213 9:133823908-133823930 CCCTCTGACGCACGCAGAGCAGG - Intronic
1062007585 9:134248909-134248931 AACACGGACACACCCAGTGCTGG + Intergenic
1062294450 9:135816720-135816742 CCCACAGGTGCACACAGAGCAGG + Intronic
1186009481 X:5113518-5113540 AGCAGAGAATCACCCAGAGCAGG - Intergenic
1187391472 X:18889135-18889157 ACCACAGACACCCCCAATGCTGG - Intergenic
1188369448 X:29350620-29350642 ACCACACACACACCCAGCGATGG + Intronic
1192069692 X:67923752-67923774 TCTACAGACTCACCCAGACCTGG + Intergenic
1193968441 X:88019760-88019782 AACACACACACACACAGAGCTGG - Intergenic
1196798448 X:119521320-119521342 ACCCTAGATGCCCCCAGAGCAGG - Intergenic
1198482280 X:137052224-137052246 ACCTCACAATCACCCAGAGCTGG - Intergenic