ID: 1161337375

View in Genome Browser
Species Human (GRCh38)
Location 19:3721809-3721831
Sequence CCCTCCCCCAGCCCGGGGTG GGG
Strand +
Crispr in exon? Yes
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 638
Summary {0: 1, 1: 0, 2: 5, 3: 66, 4: 566}

Found 6 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1161337361_1161337375 10 Left 1161337361 19:3721776-3721798 CCGGCCCTCAGCCCGCTGTGACT 0: 1
1: 0
2: 2
3: 30
4: 222
Right 1161337375 19:3721809-3721831 CCCTCCCCCAGCCCGGGGTGGGG 0: 1
1: 0
2: 5
3: 66
4: 566
1161337360_1161337375 11 Left 1161337360 19:3721775-3721797 CCCGGCCCTCAGCCCGCTGTGAC 0: 1
1: 0
2: 2
3: 19
4: 227
Right 1161337375 19:3721809-3721831 CCCTCCCCCAGCCCGGGGTGGGG 0: 1
1: 0
2: 5
3: 66
4: 566
1161337362_1161337375 6 Left 1161337362 19:3721780-3721802 CCCTCAGCCCGCTGTGACTCTCC 0: 1
1: 0
2: 1
3: 43
4: 196
Right 1161337375 19:3721809-3721831 CCCTCCCCCAGCCCGGGGTGGGG 0: 1
1: 0
2: 5
3: 66
4: 566
1161337364_1161337375 -1 Left 1161337364 19:3721787-3721809 CCCGCTGTGACTCTCCTCAGCCC 0: 1
1: 0
2: 4
3: 63
4: 342
Right 1161337375 19:3721809-3721831 CCCTCCCCCAGCCCGGGGTGGGG 0: 1
1: 0
2: 5
3: 66
4: 566
1161337365_1161337375 -2 Left 1161337365 19:3721788-3721810 CCGCTGTGACTCTCCTCAGCCCC 0: 1
1: 2
2: 8
3: 52
4: 450
Right 1161337375 19:3721809-3721831 CCCTCCCCCAGCCCGGGGTGGGG 0: 1
1: 0
2: 5
3: 66
4: 566
1161337363_1161337375 5 Left 1161337363 19:3721781-3721803 CCTCAGCCCGCTGTGACTCTCCT 0: 1
1: 0
2: 25
3: 57
4: 377
Right 1161337375 19:3721809-3721831 CCCTCCCCCAGCCCGGGGTGGGG 0: 1
1: 0
2: 5
3: 66
4: 566

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1161337375 Original CRISPR CCCTCCCCCAGCCCGGGGTG GGG Exonic
900087583 1:905833-905855 CCCTGCTCCAGGCCGCGGTGGGG - Intergenic
900143782 1:1149521-1149543 CCCCTCCCCAGCCCGAGGGGAGG + Intergenic
900354053 1:2251421-2251443 CCCTGCCCCAGCCCCTGCTGAGG + Intronic
900407826 1:2500182-2500204 CCCTGCCCCAGGTCAGGGTGGGG + Intronic
900646232 1:3709964-3709986 CCCACCCCCTGCCAGGTGTGTGG + Intronic
900929738 1:5729028-5729050 CCCTTGCCCATCCAGGGGTGGGG - Intergenic
901431276 1:9216454-9216476 CCCACCCCCAGCTCCTGGTGGGG - Intergenic
901602454 1:10432616-10432638 CCCTCCCCCTGGCTGGGCTGGGG - Intronic
901685730 1:10942340-10942362 AACTCCTCCAGCCAGGGGTGGGG - Intergenic
901702660 1:11053887-11053909 CCCAGCCCCTGCCCAGGGTGGGG + Intergenic
902142100 1:14365355-14365377 CCCCCCCCCACCCCGGGGGGAGG - Intergenic
902416522 1:16242967-16242989 CCCTCCTCCAGCCCGCCCTGAGG + Intergenic
902431577 1:16367410-16367432 ACCACCCCCAGCCCGGCGTATGG - Intronic
902700645 1:18169620-18169642 CCTGCCCCCAGCCCAGGGTAGGG + Intronic
902701974 1:18178759-18178781 CCCTACCCCACCCCAGGGTCTGG + Intronic
902997289 1:20236423-20236445 CCCTTCCCCAGCTCAGAGTGGGG - Intergenic
903216992 1:21848783-21848805 CACCCTCCCAGCCCAGGGTGTGG - Exonic
903287246 1:22284981-22285003 CCCAGGCCCAGCCCAGGGTGAGG - Intergenic
903788297 1:25875566-25875588 CCCTCCCCCGGCTTGGGGCGGGG - Intergenic
903947706 1:26974000-26974022 CCCCCCACCACCCAGGGGTGGGG - Intergenic
903967644 1:27100335-27100357 CCCTCCCCAGGCTCAGGGTGTGG + Exonic
904044451 1:27601712-27601734 CTGTCCCCCAACCTGGGGTGGGG - Intronic
904263005 1:29301175-29301197 CCCTCCTCCTGCTCTGGGTGAGG - Intronic
904384242 1:30131255-30131277 CCCCTCCCCAGCCTGTGGTGGGG - Intergenic
904575468 1:31502508-31502530 CCTTCCCCCAGCACAGTGTGTGG + Intergenic
905037806 1:34929309-34929331 CCCTCCCCCCTCCCGGGGCCGGG + Intronic
905179347 1:36156650-36156672 CCCTCCCCCACCCCGGGTGCCGG + Intronic
905182938 1:36177931-36177953 CCCTGCCCCAGCCCAGGGCCAGG + Exonic
905362812 1:37431938-37431960 ACCTCCCTCAGCCCTGTGTGTGG - Intergenic
905653616 1:39672183-39672205 ACCTCCCCCCGCCCGGCGGGCGG - Intergenic
905867807 1:41385727-41385749 CCCTCCGTCAGCCTAGGGTGGGG - Intergenic
906284094 1:44574747-44574769 CTGACCTCCAGCCCGGGGTGGGG + Intronic
907237729 1:53063076-53063098 CCCCGCCCCAGGCCGGGCTGTGG - Intronic
907441398 1:54480693-54480715 CCCTTCCCCAGCTGGGGGTGGGG + Intergenic
907450410 1:54542451-54542473 CCCTTCCCCCGCGCGGGGCGGGG - Intronic
909344115 1:74565413-74565435 GCCTCCAGCAGCCTGGGGTGGGG + Intergenic
909698292 1:78491555-78491577 CACTCCCCGTGCCCGGGATGAGG + Intronic
912412663 1:109489199-109489221 CACTCCCTCAGCCCTGAGTGTGG + Intronic
912698863 1:111861425-111861447 CCCTCCCCCAGCCCAGTCTCAGG + Intronic
913615765 1:120558342-120558364 CCCGCCCCCTGCCCGAGGGGCGG - Intergenic
914213974 1:145607931-145607953 CCCACCCCGAGCCCGAGGCGGGG + Intergenic
914348117 1:146817188-146817210 CCCTACACCAGCCAGGGGTCTGG - Intergenic
914465917 1:147928334-147928356 CCCACCCCGAGCCCGAGGCGGGG + Intergenic
914574510 1:148952560-148952582 CCCGCCCCCTGCCCGAGGGGCGG + Intronic
914845422 1:151281356-151281378 CCCGCCCCCAGCATGGAGTGGGG - Intronic
914922047 1:151853753-151853775 CCCTCCCCAAGCACTGGGTGGGG - Intergenic
915003856 1:152618850-152618872 CCCCCCCCCAGCCTGGTGTTGGG - Intergenic
915310466 1:155003715-155003737 ACCTGCCCCAGCCCAGAGTGGGG + Intronic
915333504 1:155127795-155127817 CCCTCGCCCCGCCCGGCGCGCGG - Exonic
915463337 1:156082215-156082237 CCCACCCCCACCCCGGGGGCTGG - Intergenic
915525856 1:156475841-156475863 CTCACCCCCAGCCAGGAGTGGGG - Intronic
915629093 1:157138177-157138199 CCCGCCCCCCGCACTGGGTGAGG + Intronic
915709454 1:157880794-157880816 CCCTCCCACAGCCTGTGTTGTGG - Intronic
916212037 1:162367263-162367285 CCCGCCCCCAGCGCAGGGCGAGG + Exonic
916361888 1:163979497-163979519 CCCTACCCCAGTCAGGTGTGGGG + Intergenic
916868553 1:168887408-168887430 CCCTGCCCCAGCCCTGGCTAAGG - Intergenic
918020357 1:180681702-180681724 CTCTCTCCCAGGCTGGGGTGTGG + Intronic
918343787 1:183589036-183589058 CCTTCCTCCAGCCAGAGGTGGGG + Intronic
919731112 1:200914109-200914131 TTCTCCCCCAGCCCAGGCTGGGG - Intronic
920247346 1:204598298-204598320 GCCATCCCCAGGCCGGGGTGCGG - Intergenic
920366324 1:205450080-205450102 CCCTCCCCCAGCCCTGAGGACGG + Intronic
920674281 1:208028677-208028699 TCCTCCCGCAGCAGGGGGTGTGG + Intronic
921179989 1:212624691-212624713 GCCTCCCAGAGGCCGGGGTGGGG - Exonic
921292369 1:213670613-213670635 CCCTCCCCCAGGCCAGGATAGGG + Intergenic
921692209 1:218164742-218164764 CCTCCCCGCTGCCCGGGGTGCGG + Intergenic
922163702 1:223097408-223097430 CGCTCCCCCAGCCCCTGATGGGG - Intergenic
922216815 1:223526593-223526615 TCTTCCCCCAGCCAGGGCTGTGG - Intergenic
922526500 1:226308688-226308710 CCCTCCCCCGGCCCCGGGACAGG + Intronic
922765863 1:228156565-228156587 CCCTCTTCCTGCCCCGGGTGGGG + Intronic
924105270 1:240643180-240643202 CCATCACCCAGGCTGGGGTGTGG - Intergenic
1062768236 10:81184-81206 CACTCCCCCAGCACAGGGTCTGG + Intergenic
1062858969 10:794888-794910 CCCTCCCCCACCCCCTGGTAGGG - Intergenic
1063428131 10:5965522-5965544 CCCTCCCACAGCCCGCAGTGTGG + Intronic
1064679643 10:17797030-17797052 CCCACCCCCAACCCTGGCTGTGG + Exonic
1065024210 10:21526071-21526093 CCCGCCGCCAGCCCCGGGGGAGG + Intergenic
1065844980 10:29736471-29736493 CGCTCTCCCGGCCGGGGGTGTGG + Intronic
1066484447 10:35830010-35830032 CCTTGCCCCAGCTCGGGGAGGGG - Intergenic
1067238728 10:44472780-44472802 CTCTCCCCCAGCCCCTGGTGTGG + Intergenic
1067713634 10:48670800-48670822 CCCTCCACCAGCGGGGGGTGGGG + Intergenic
1067944235 10:50680249-50680271 CCTTCCCCCAGCCCCATGTGAGG - Intergenic
1069616657 10:69810827-69810849 CCCAGCCACAGCCCTGGGTGTGG + Intronic
1070846902 10:79530607-79530629 CCGTCACCCAGGCTGGGGTGCGG + Intergenic
1071087087 10:81876260-81876282 CCCTCCCCCATCCCAGGTTTGGG + Intronic
1072151781 10:92689996-92690018 CCCGCCGCCGGCCCGGGGTGCGG - Exonic
1072620248 10:97074834-97074856 GCCTCCTCCAGCCCTGGGAGAGG - Intronic
1072622552 10:97089659-97089681 CCCTCCCCCAGCCATGAGTAAGG - Intronic
1073103456 10:101019050-101019072 CCCGCCCCCAGCCTGGGCCGCGG + Exonic
1073121863 10:101126814-101126836 TCCTCCCCCAGCCCGGGCCCTGG + Intronic
1073146391 10:101284553-101284575 CTCGCCTCCAGCCCGGGGTAAGG + Intergenic
1073208338 10:101780290-101780312 TTCTCCCCCAGCCCGTGGTGAGG - Intronic
1073322868 10:102626199-102626221 CCCTCACCCAGGGCGTGGTGGGG + Intronic
1073452661 10:103618861-103618883 CCCTCCCACAGCTGGGGGTTGGG - Intronic
1073489889 10:103846144-103846166 CCCTCCCCAAGCCTGGGCGGAGG - Intronic
1073800730 10:107038677-107038699 CCCGCCCCCTGCCCAGGGTTGGG - Intronic
1073927367 10:108532867-108532889 CCCTCCCCCAGCCAGGCTTGCGG - Intergenic
1074416791 10:113273784-113273806 CCCTCCTGCAGCCCGCCGTGGGG - Intergenic
1074490345 10:113934310-113934332 TCCTCCCCCAGCCCTGGGTTGGG + Intergenic
1075079174 10:119371244-119371266 CTCTCCCCTAGCCCGGTGGGAGG + Intronic
1075717541 10:124565828-124565850 CCCTGCTCCAGCCCGGCGTCGGG + Intronic
1075734305 10:124654640-124654662 CCCACCCCCAGCTCGGGTGGTGG + Intronic
1075794011 10:125106239-125106261 TCCTCCCACAACCCTGGGTGTGG + Intronic
1075806707 10:125194232-125194254 CCCTCTCCCAGCCCAGGCTCTGG - Intergenic
1076058236 10:127392744-127392766 CCCACCCCCAGCGCCGGGTCGGG + Intronic
1076775937 10:132698232-132698254 CCCTCTCCCAGCTGGGCGTGCGG - Intronic
1076916665 10:133425837-133425859 CCCTCCCCTGGCCCTGGGAGGGG + Intergenic
1076936769 10:133570632-133570654 CCCTCCCCTGGCCCTGGGAGGGG + Intergenic
1077042638 11:531346-531368 CCCTCCCAGGGCCCGGGTTGAGG - Intergenic
1077063433 11:627325-627347 CCCTCCCCCAGCCGGCCGAGGGG - Intergenic
1077176830 11:1194940-1194962 CTGTCCCCCAGCTGGGGGTGGGG + Intronic
1077233536 11:1469199-1469221 CCCGCCACCAGCACGGGGAGAGG + Intergenic
1077250459 11:1558501-1558523 CCCACCACCAGCCGTGGGTGGGG - Intronic
1077251581 11:1563160-1563182 CCCTCCCCCATCCAGGTCTGGGG - Intronic
1077284026 11:1757999-1758021 CCCTCCCCCAGCCCTGGATGAGG + Intronic
1077333300 11:1992845-1992867 CCAGCCCCCGCCCCGGGGTGCGG + Intergenic
1077366804 11:2164546-2164568 CCCTCACCCAGCCCTGGAAGAGG - Intronic
1077373629 11:2195164-2195186 CCCCCTCCCTGCCCGGGGAGGGG + Intergenic
1077504288 11:2922899-2922921 CCCTCCCCCAGCACGGGGAGTGG + Intronic
1077550137 11:3196564-3196586 CCCTCCCCCTGCCCGGGCCCAGG - Intergenic
1078164561 11:8871066-8871088 CCCGGCCGCAGCCCGGGGCGCGG - Intronic
1078189254 11:9077971-9077993 CCCCCCGCCACCCCGGGCTGTGG + Intronic
1078542348 11:12222368-12222390 CCCTCCCCCTGCCTGGGTGGAGG + Intronic
1080012317 11:27471992-27472014 CCCTCCCCAGGCCCGGGCGGCGG + Intronic
1080386325 11:31813078-31813100 GCCCTCCCCAGCCCGGGGAGGGG - Intronic
1080489977 11:32751644-32751666 CCCTCCCCCAGCCCCTGCAGTGG - Intronic
1081487980 11:43546766-43546788 CCCTCCTCCAGCCTGGGGTTGGG - Intergenic
1081831464 11:46119877-46119899 CCCTCCCCCCGGCGGGGGCGCGG + Intronic
1082787656 11:57325622-57325644 CCTTCCCGCAGCCGGGGGAGTGG - Intergenic
1082816831 11:57514827-57514849 CCCCCCTCCAGCCCCGGGAGGGG + Intronic
1082820796 11:57543484-57543506 CCCTCCCCCACCCTGGGCTCTGG - Intronic
1083347148 11:62001515-62001537 CCCTCCCAGATCCCAGGGTGAGG - Intergenic
1083431450 11:62615521-62615543 CCCTCCCCTAGCCTGCCGTGTGG - Exonic
1083658370 11:64241144-64241166 GCTCCCCCCAGCCCGGGCTGTGG - Intronic
1083668096 11:64286060-64286082 GCCTCCCCCAGCTTGGGGAGGGG + Intronic
1084164286 11:67367707-67367729 CCCCCACCCAGCCCAAGGTGGGG - Intronic
1084546247 11:69816502-69816524 CCAGCCCTGAGCCCGGGGTGTGG - Intronic
1084680182 11:70662396-70662418 CCCTCTCCCAGCCCAGCCTGCGG - Intronic
1084775304 11:71370848-71370870 CCCTCCTCCAGCCAGGGCTGGGG - Intergenic
1085126438 11:74005663-74005685 CCCTGCCCCAGCCTGAGGGGAGG + Intronic
1085277977 11:75312155-75312177 CCCTCGCCCTCCCCGGGGAGTGG + Intronic
1085674854 11:78506965-78506987 CCCTCTCCCAGCCCTGAGGGAGG + Intronic
1088815753 11:113419679-113419701 CCCTCCCGCAACCCGGAGTAGGG + Intronic
1089432803 11:118437001-118437023 CCCTCCCCCATCCGGGATTGAGG + Intronic
1089688236 11:120170216-120170238 CCCTCCCCCAGCCCCGCCTCTGG - Exonic
1089700384 11:120240703-120240725 CACTCACTCAGCCAGGGGTGTGG + Intronic
1091104149 11:132902690-132902712 CCCTCCCTGTGCCAGGGGTGAGG - Intronic
1202816280 11_KI270721v1_random:48026-48048 CCAGCCCCCGCCCCGGGGTGCGG + Intergenic
1091521956 12:1254547-1254569 CCCTCTCCCAGGCTGGAGTGTGG + Intronic
1091616487 12:2054010-2054032 CCCTCGCCCGGCTCGGGGCGCGG + Intronic
1091646134 12:2273796-2273818 CCCTAACCAAGCCCGGGGTCAGG - Intronic
1091761871 12:3092921-3092943 AGCTCCCCCAGCCCTGGGCGTGG - Intronic
1091779104 12:3202686-3202708 CCCCCTCCCTGCCTGGGGTGTGG + Intronic
1092094245 12:5828266-5828288 CCCTCCCCCAGCCTGGAGCCCGG + Intronic
1092487426 12:8914613-8914635 CCCTCCCGCCGCTCCGGGTGCGG - Exonic
1092821414 12:12357009-12357031 CCCTCCCTCGGGCCGGGGGGCGG + Intergenic
1092826384 12:12403713-12403735 CCCTCCCTCAGCCCTGGGATTGG + Intronic
1094493564 12:30976073-30976095 CCCTCACCCCACCCAGGGTGAGG - Intronic
1096007395 12:48184056-48184078 CCCTCCCCCACCCCGGAGGCCGG + Exonic
1096231740 12:49900577-49900599 CCTTCCCCGAGCCCGTGCTGGGG - Intronic
1096810733 12:54168079-54168101 ACCTCCCCAAGTCAGGGGTGAGG + Intronic
1096946746 12:55415028-55415050 CCCTCCCGCCGCTCCGGGTGCGG + Intergenic
1097167755 12:57094653-57094675 CCCTCCACCAGCGCGGGATGGGG - Exonic
1098143042 12:67469972-67469994 CCCTGCTGCAGCCAGGGGTGGGG + Intergenic
1099960457 12:89392151-89392173 CCCTCCCCCACTCCAGGGTCAGG + Intergenic
1100997657 12:100320253-100320275 ACCGCACCCAGCCCGGGATGAGG - Intronic
1101466760 12:104957854-104957876 GCTTCCCTCAGCCCGAGGTGGGG + Intronic
1101828630 12:108240322-108240344 CCTTCCCGCAGCCAGAGGTGAGG - Exonic
1102238250 12:111308229-111308251 CTCTCCTCCAGCCCGGGGGCTGG + Intronic
1102466838 12:113135161-113135183 CCCTCCCCTGCCCGGGGGTGAGG + Intronic
1102525551 12:113510103-113510125 GCCTCCTCCATCCTGGGGTGGGG + Intergenic
1103145144 12:118589194-118589216 CTCTAACCCAGCCTGGGGTGTGG - Intergenic
1103294797 12:119877109-119877131 GCCTCCCGCAGCCCTGGGGGTGG + Intronic
1103982561 12:124746069-124746091 TCCACCCCCAGCCGGGGGAGGGG - Intergenic
1104286680 12:127430699-127430721 CCATCCCCCAGCCCTGAGGGAGG + Intergenic
1104850803 12:131872618-131872640 CTCTCCACCAGGCCCGGGTGAGG - Intergenic
1104947811 12:132424666-132424688 ACCTCTCCCAGCTTGGGGTGGGG + Intergenic
1105303646 13:19155041-19155063 CCCTTCTCCAGACAGGGGTGGGG + Intergenic
1106087552 13:26557455-26557477 TCCGCCCCCAGCTCGGGATGAGG - Intergenic
1106157223 13:27170955-27170977 CTTTCCCCCAGCGCGGGGTCGGG + Intronic
1107813092 13:44218977-44218999 CCCTCTGCTTGCCCGGGGTGTGG - Intergenic
1107988502 13:45796789-45796811 CCGTCCCTCAGCTCGGTGTGAGG - Intronic
1108072925 13:46647949-46647971 CTTTTCCCCAGACCGGGGTGGGG + Intronic
1108072927 13:46647954-46647976 CCATCCCCCACCCCGGTCTGGGG - Intronic
1110705881 13:78602010-78602032 GCCGCCACCAGCCCGGGGTGCGG + Exonic
1111600277 13:90464540-90464562 CTCTCACCCAGGCTGGGGTGCGG + Intergenic
1111654213 13:91132045-91132067 CCTTCCCCCAGCCAGGAGTGTGG - Intergenic
1112503028 13:99956760-99956782 CTCTCCCCCAGCCCGCGGCCCGG - Intergenic
1112507393 13:99983064-99983086 CCCTGCCCCTTCCCGGGCTGTGG + Exonic
1113778516 13:112962704-112962726 CCCTCCCAGAGCCTGGGGGGAGG - Intronic
1113798174 13:113071039-113071061 CCTTTCCCCAGCACGTGGTGGGG + Intronic
1113957279 13:114105517-114105539 CCCTCCTCCAGCACGGGGACAGG + Intronic
1114270624 14:21098226-21098248 CCCTCCCCCCTCCCGGAGGGGGG - Intronic
1114484662 14:23055644-23055666 CCCTGCCCAGGCCCGGGCTGGGG + Exonic
1118777091 14:68979691-68979713 CCCCCTCCCACCCCGGGGTTTGG - Intergenic
1119296553 14:73537804-73537826 ACTTCCTCCCGCCCGGGGTGCGG + Exonic
1119300795 14:73569809-73569831 ACTTCCTCCCGCCCGGGGTGCGG + Exonic
1121008382 14:90504927-90504949 CCTTCCAGCAGCCCTGGGTGGGG + Intergenic
1121050523 14:90816538-90816560 CCCTGCCCCAGCCCTGGCTCCGG - Intergenic
1121127569 14:91417863-91417885 CCTTCCCCCAGACCCGGGCGGGG - Intergenic
1121311820 14:92939463-92939485 CGGCCCCCCAGCCCTGGGTGTGG + Exonic
1121411070 14:93748606-93748628 CCCTTCCTGAGCCCTGGGTGAGG + Intronic
1121507104 14:94485833-94485855 CCCTGCCCCAGCCTGAGGGGTGG - Intergenic
1122278919 14:100609974-100609996 CCCTCCCCCAGCCCTGGGGCAGG - Intergenic
1122307855 14:100776894-100776916 GCCTCCTCCAGCCCACGGTGGGG - Intergenic
1122632505 14:103113479-103113501 GCCTCCCCCAGCTCAGGCTGGGG + Intergenic
1122707247 14:103629111-103629133 CCCTCGCCCCGCCCGGGGCTGGG - Intronic
1122771512 14:104099886-104099908 GCCCCACCCAGCCCCGGGTGAGG - Intronic
1122784587 14:104157880-104157902 CCCCCACCGAGCCCGGGGTGGGG - Exonic
1122793148 14:104192887-104192909 CCCTGCCTCAGCTCTGGGTGAGG - Intergenic
1122863236 14:104591854-104591876 CCCTCATCGAGCCCCGGGTGGGG + Intronic
1123002209 14:105301484-105301506 CACTCCCAGAGCCCGGGGTTGGG - Exonic
1123006581 14:105326672-105326694 CCCACCTCAAGCCTGGGGTGTGG + Intronic
1123052173 14:105549800-105549822 CCGCCCCCCAGGCCTGGGTGCGG + Intergenic
1123056938 14:105575161-105575183 CCCTCCCCCAGGCAGGTGTGAGG + Intergenic
1123081272 14:105696624-105696646 CCCTCCCCCAGGCAGGTGTGAGG - Intergenic
1124109461 15:26772970-26772992 CCCTCCCCCGTGCCGGGGCGCGG - Exonic
1124249347 15:28096939-28096961 CCCGCTCCCAGCCCGGGGCCAGG + Intronic
1124369894 15:29098704-29098726 TCCTCCCGCAGCCCGGGCTATGG - Intronic
1125003730 15:34795850-34795872 CCCTCCCCCTTTCTGGGGTGTGG + Exonic
1127922465 15:63504415-63504437 CCCCCGCCCAGCCCGCGGGGTGG - Intergenic
1128451270 15:67807155-67807177 CCTGCCCCCAGCCCTGGGGGGGG - Intergenic
1128841373 15:70853920-70853942 CGCTGCCCCAGCCGGGGCTGAGG + Exonic
1129410501 15:75348080-75348102 CCCTCCCCCAGGCCCGGGGCAGG + Intronic
1129862365 15:78872723-78872745 CCCTCCCCCACCCGGGGGGGGGG + Intronic
1129862372 15:78872728-78872750 CCCCCCCCCCCCCCCGGGTGGGG - Intronic
1130252198 15:82306944-82306966 CCCTGCTCCAGCCCGGGGACTGG - Intergenic
1131831985 15:96360242-96360264 CGCTGCCCCAGCCTGGGGTGCGG - Intergenic
1132079473 15:98852305-98852327 CCCTCACCCGGGGCGGGGTGGGG - Intronic
1132544461 16:527036-527058 CCCTCCCCCAGGCCCTGGTTGGG + Intergenic
1132546276 16:534802-534824 CCCTGCCCGAGCTGGGGGTGTGG - Intronic
1132549682 16:549208-549230 CCTTCTCCAAGGCCGGGGTGGGG + Intronic
1132583031 16:694070-694092 CCGCCCCCCTGCCCGGGGCGGGG + Exonic
1132832023 16:1933093-1933115 CCCTCCCCCAGCATGTGCTGTGG - Intergenic
1132977855 16:2719532-2719554 CCCTCTCCCAGTCCTGGGTCAGG - Intronic
1133002419 16:2858068-2858090 AGCGCCCCCAGCCCTGGGTGGGG - Exonic
1133037041 16:3039324-3039346 CTCTCCCCCAGGCTGGAGTGCGG + Intergenic
1133295500 16:4750015-4750037 CCCTCCCCCTGCCGAGGCTGTGG - Exonic
1133972589 16:10578545-10578567 CCCTCCTCCAGCCCGAGGTGGGG + Intronic
1133997821 16:10761774-10761796 CCCTCCCACAACCGGGGGCGCGG + Exonic
1134440090 16:14294296-14294318 CCATCCCCCAGGCTGGAGTGTGG - Intergenic
1135015973 16:18925793-18925815 TCCTCCCCCAGCCGGGGCGGAGG + Intronic
1135321592 16:21501620-21501642 TCCTCCCCCAGCCGGGGCGGAGG + Intergenic
1135437358 16:22437599-22437621 TCCTCCCCCAGCCGGGGCGGAGG - Intergenic
1136110993 16:28063575-28063597 CCCCCCCCAACCCCGGGGTGGGG + Intergenic
1136110999 16:28063580-28063602 CGCGCCCCCACCCCGGGGTTGGG - Intergenic
1136333070 16:29594730-29594752 TCCTCCCCCAGCCGGGGCGGAGG + Intergenic
1136464044 16:30429849-30429871 GCCTGGCCCAGCTCGGGGTGGGG - Intronic
1136483170 16:30555375-30555397 CCCTACCCCTGCCCGCAGTGCGG - Exonic
1136483211 16:30555543-30555565 CCCTTCCCCTGCCCGGACTGTGG - Exonic
1136544632 16:30948438-30948460 CCTTCCTCGAGCGCGGGGTGGGG + Exonic
1136569089 16:31086276-31086298 CCAACCCCCAGCCCAGGGTTAGG + Intronic
1138245208 16:55462354-55462376 CCTCCCCCCAGGCCGGGCTGAGG - Intronic
1138517360 16:57543622-57543644 CCCTGCCCCTGGCCTGGGTGAGG - Intronic
1139372623 16:66478313-66478335 ACCTGCCCCAGCCGGGCGTGGGG + Intronic
1139469494 16:67170611-67170633 CCCTCCCACAGCCGGGAGTGGGG - Intronic
1139985920 16:70898357-70898379 CCCTACACCAGCCAGGGGTCTGG + Intronic
1140479934 16:75256998-75257020 CCCTCCCCCAGGCAGTGCTGAGG - Intronic
1141694864 16:85614426-85614448 CCCCTCCCCAGCGCCGGGTGGGG + Intronic
1141998296 16:87648652-87648674 CCCTCTCCCAGCCCAGGGCCGGG - Intronic
1142003912 16:87680044-87680066 CACACACCCAGCCCAGGGTGTGG + Intronic
1142032207 16:87844249-87844271 CCTTCCCCCCACCCGGGGTTTGG - Intronic
1142198214 16:88748534-88748556 CCCTCCCGCTGCCCGCTGTGGGG - Intronic
1142232062 16:88904662-88904684 CCCCCGCACAACCCGGGGTGGGG - Intronic
1142308287 16:89298009-89298031 CCCATCTCCAGGCCGGGGTGGGG + Intronic
1142664803 17:1456382-1456404 CCCTTCCCGGGCCCGGGCTGCGG + Intronic
1142708549 17:1710791-1710813 CCCTCCCCGCGTCCGTGGTGGGG + Intergenic
1142742758 17:1940643-1940665 CCCCCTCCCAGCCCTGGGTGTGG - Intronic
1143119771 17:4599518-4599540 CCCACACCCACCCCAGGGTGAGG + Intronic
1143462400 17:7112338-7112360 CCCTCCAGCAGCCCGGGTGGTGG - Intronic
1143783378 17:9240741-9240763 CCCTGCCCCTGCCCAGCGTGGGG + Exonic
1144949422 17:18985892-18985914 CCCTACCCCAGCCCAGGGCCTGG + Intronic
1145062848 17:19743563-19743585 CACTCACCCAGCCCAGGGTGGGG + Intronic
1145224576 17:21117189-21117211 CCCTCCTCCAGCAGGCGGTGGGG - Intergenic
1145269680 17:21398046-21398068 CCCTCACCCAGCCCTGGCAGTGG - Intronic
1146124454 17:30220786-30220808 TCCTCCCCCAGCCAGAAGTGAGG - Intronic
1146276722 17:31521099-31521121 CCCAGCCACAGCCCGTGGTGGGG - Intronic
1147178948 17:38673293-38673315 CCCTCCTCAAGCCCGCGGTTTGG + Exonic
1147608217 17:41786100-41786122 TACTCCCCCAGGCCTGGGTGGGG - Intronic
1147961519 17:44170562-44170584 CCAACCCCCAGCCCAGGGTGAGG - Intronic
1148462723 17:47847640-47847662 CTTTCCCGCAGCCCGGGATGTGG + Exonic
1148554283 17:48568971-48568993 CAATACCCCAGCCCGCGGTGTGG + Intronic
1148690646 17:49524992-49525014 GCCTCCTGCAGCCTGGGGTGAGG - Intergenic
1148945604 17:51259904-51259926 CCTGCCCCCAGCCCGGGGAGGGG - Exonic
1150137818 17:62705149-62705171 CCCTCCCCAAGCCCTGGCAGGGG - Intronic
1150239900 17:63622811-63622833 TCCTCCCTCAGCCTGGGGCGGGG - Intronic
1151668200 17:75557601-75557623 CCCTCCCCCACACCGGGCAGAGG - Intronic
1151758820 17:76089363-76089385 GCCGCCCCCAGCCAGGAGTGTGG - Intronic
1152012585 17:77727417-77727439 CCCTCCCCCAGCCAAGGTGGAGG - Intergenic
1152020960 17:77780021-77780043 CTCTCCCCCAGCCCCGGGACAGG + Intergenic
1152195514 17:78916061-78916083 GCCTCCCTCAGGGCGGGGTGGGG + Intronic
1152241236 17:79162365-79162387 GCCGCCCCCAGCCCGGTGAGTGG + Intronic
1152242568 17:79168013-79168035 CCCTCACCCAGCCCTGGGGCTGG - Intronic
1152419674 17:80185663-80185685 CTTTCCCCCAGCCCAGGGTCGGG + Intronic
1152573841 17:81131711-81131733 CCCAGGCACAGCCCGGGGTGAGG - Intronic
1152614041 17:81329782-81329804 CCCTCCCCGAGGCCTGTGTGGGG - Intronic
1152829059 17:82486166-82486188 CACTCCCCCTGCCCCAGGTGGGG - Intronic
1153236900 18:2997016-2997038 CCCTCACCCAGGCTGGAGTGCGG + Intronic
1153457228 18:5295274-5295296 CCCTCCCGCGGCCGGGGGCGGGG + Intronic
1153887781 18:9482474-9482496 CCCTCACCCATCCAGGGGTGGGG - Intronic
1154497769 18:14975059-14975081 CCCACCCCCAGCCCCTGCTGTGG + Intergenic
1154980324 18:21498332-21498354 TGCTCCCCCAGCCAGGGGTTAGG + Intronic
1156460726 18:37319964-37319986 CCTTCCCCCCGCCAGGGCTGGGG - Intronic
1158897122 18:61924750-61924772 AGCACCCCCAGCCCTGGGTGAGG + Intergenic
1159770389 18:72541760-72541782 CCCGCCCCCAGCCCGGGGAGAGG - Intronic
1160308341 18:77762832-77762854 CCCTCCCACAGCACGGTGGGTGG + Intergenic
1160896839 19:1407141-1407163 CCGTCCGCCCGCCTGGGGTGCGG + Intergenic
1161044210 19:2126319-2126341 CCCTGGCCCAGCCGGAGGTGTGG + Intronic
1161075265 19:2282223-2282245 CCCCTCCCCACCCCGGGCTGCGG - Intronic
1161112176 19:2476642-2476664 CCCGCGCCCAGCCCGGGAAGGGG - Intronic
1161119657 19:2518319-2518341 CCAGCCCCCAGCCCGGGCGGAGG - Intronic
1161142244 19:2654622-2654644 CCCTCCCCCCACTCAGGGTGTGG - Intronic
1161313535 19:3607543-3607565 CCACCCCCCAGCTCGGGCTGGGG + Intergenic
1161313539 19:3607548-3607570 TCCTTCCCCAGCCCGAGCTGGGG - Intergenic
1161337375 19:3721809-3721831 CCCTCCCCCAGCCCGGGGTGGGG + Exonic
1161354935 19:3813739-3813761 CGCTGCCCCAGGCCTGGGTGTGG + Intronic
1161400748 19:4065570-4065592 CCCTCCCCCCAGCCCGGGTGGGG - Intronic
1161512127 19:4677681-4677703 TCCTTCCCCAGCCCGGGCAGTGG + Intronic
1162159284 19:8699380-8699402 CCATCCCCCAGCCTGGAGTGCGG - Intergenic
1162396405 19:10420336-10420358 CCCCCTCCCAGCCCGGAGCGGGG + Intronic
1162523912 19:11196910-11196932 CCCGCCCCAAACTCGGGGTGGGG + Intronic
1162760660 19:12886385-12886407 CCTTCCCCCATCCCCGAGTGTGG - Intronic
1163303362 19:16462036-16462058 CCCTCCCGGAGCCCATGGTGTGG + Intronic
1163448960 19:17364372-17364394 ACCACACCCAGCCTGGGGTGGGG + Intronic
1163667434 19:18609950-18609972 CCCTCCCCCAGCCCAAGGGGAGG - Intronic
1165092667 19:33395043-33395065 CCCTCACCCACTCCTGGGTGGGG + Intronic
1165149462 19:33752231-33752253 ACCACCCCCTGCCCGGGGAGAGG + Intronic
1165382429 19:35490564-35490586 CCCTCCCAGAGCCCCGGGGGTGG - Intronic
1165453708 19:35899288-35899310 ACCGCTCCCGGCCCGGGGTGAGG - Intronic
1165549752 19:36573726-36573748 GCCTCCCTCAGCCTGGGGTCCGG - Intronic
1165726158 19:38114533-38114555 CCATCCCCCTGCCTGGGGTAAGG + Intronic
1166230890 19:41425431-41425453 GCCTCCCCCAGCCAGGGGCCTGG - Exonic
1166256120 19:41606156-41606178 CCCTCCTCCAGCAGGAGGTGTGG + Intronic
1166313211 19:41974987-41975009 CCCTCTGCCAGCCTGGGCTGGGG - Intronic
1166327787 19:42061868-42061890 CCCTCGCCCTGCCCGGCGTGGGG + Intronic
1166367406 19:42284480-42284502 GCCTCCCGCCGCCCGGGGGGCGG - Intronic
1167134819 19:47609916-47609938 CCCTCCCCCACCCCCAGCTGAGG + Intronic
1167559203 19:50215244-50215266 TCCTCCGCCAGCCAGGAGTGGGG + Intronic
1167595859 19:50427860-50427882 CCCCCCCCCCCCCCGTGGTGAGG + Intronic
1167671172 19:50854771-50854793 CCCTTCCACAGCTCTGGGTGTGG + Intergenic
1167673943 19:50873289-50873311 CCCTTCCACAGCTCTGGGTGTGG + Exonic
1167748848 19:51368109-51368131 CCTGCCCCCAACCCGGTGTGTGG + Intronic
1168097847 19:54125675-54125697 CCACCCCCCAGCCCTGTGTGGGG + Intronic
924982964 2:239984-240006 CCTTCCCCCAGCCCCTGGTCAGG + Intronic
925009071 2:468352-468374 CGCTTCCCAAGCCCCGGGTGAGG + Intergenic
925150882 2:1613910-1613932 CCCTCTCCCAGCAGGAGGTGTGG - Intergenic
926801836 2:16665907-16665929 CCCGCCCCCAGCCCGGCTCGCGG + Intronic
927574512 2:24190183-24190205 CCCTTCCCCAGCCATGGCTGAGG - Intronic
927809079 2:26172254-26172276 CCCTTCCACAGCACGCGGTGTGG - Intergenic
927920826 2:26970853-26970875 CCCTCCCCCAGCCCGGGCCCTGG - Intronic
929666531 2:43838329-43838351 CCCTCCCCCTGCCCAGGGAAGGG - Intronic
930529666 2:52572974-52572996 GCCACCCCCAGCCCGTGGTCAGG + Intergenic
930671909 2:54160258-54160280 CCTTCCCCCAGCCTTGAGTGTGG - Intronic
930798615 2:55419701-55419723 CCCTTCCCCTCCCGGGGGTGGGG + Intronic
931879180 2:66548876-66548898 CCCTTCCCCAGCCCAGGCTTTGG - Intronic
932435212 2:71699331-71699353 TCCTCCCCCAGCTGGGGCTGGGG + Intergenic
932495494 2:72143934-72143956 CCCTCCCCCACCTCGGGGCAAGG - Intronic
933290509 2:80433290-80433312 CCCTTCCCCAGACGGGGATGAGG - Intronic
933536744 2:83584939-83584961 CCCACCCCCAGCACAGGGAGGGG - Intergenic
934748568 2:96776648-96776670 CTCTCGCCCAGCCTGGAGTGCGG + Intronic
935263579 2:101375692-101375714 CCCTACCCCAGGACGGGGTGGGG + Intronic
936075006 2:109396192-109396214 CCCTCCCACAGCCCTCCGTGGGG - Intronic
936900954 2:117481469-117481491 CCCACCACCAGCCTGGAGTGTGG - Intergenic
937042569 2:118833784-118833806 CCCTCCCGCTACCCCGGGTGGGG - Intergenic
937207427 2:120245712-120245734 CCCTCCCCCGGGGCAGGGTGTGG + Intronic
938077355 2:128346847-128346869 CCGCTCCCCGGCCCGGGGTGAGG - Intergenic
938131314 2:128717906-128717928 CCCACCCCCAGACCTGTGTGTGG - Intergenic
939956470 2:148531754-148531776 GCTGCCCCCAGCCTGGGGTGGGG + Intergenic
941018534 2:160384158-160384180 CCCTCGCCCAGGCTGGAGTGCGG - Intronic
941951284 2:171160169-171160191 CCATCCCCCACCCCAGGGTCTGG + Intronic
942220211 2:173761784-173761806 CCATCTCCCAGGCCGGAGTGCGG - Intergenic
944143798 2:196484738-196484760 CCCTCCCCAACCCCGGGGAGTGG + Intronic
946409117 2:219507680-219507702 CCCTTCCCCAGCTGTGGGTGTGG + Intergenic
946874159 2:224111265-224111287 CCCACCACCAGCCTGGAGTGTGG + Intergenic
947118851 2:226797361-226797383 CACCCCACCAGCCCGCGGTGAGG - Exonic
947576246 2:231277181-231277203 CCCTGCCCCAGCCCTGGAGGTGG + Intronic
947712170 2:232322473-232322495 CCCTCCCCATGCACTGGGTGTGG + Intronic
947718666 2:232354346-232354368 CCCTCGCCCAGGCCTGAGTGTGG - Intergenic
947731144 2:232432394-232432416 CCCTCGCCCAGGCCTGAGTGCGG - Intergenic
947809004 2:232988173-232988195 CCCTCCCCCACCACTGGGGGAGG + Intronic
948024365 2:234765101-234765123 TTCTCCCCCAGCCCTGGGTGGGG - Intergenic
948194795 2:236087300-236087322 CCCGCCCCCACCCCGGGCTCTGG - Intronic
948423543 2:237874833-237874855 CCCTCCACCAGCCCTGAGTGAGG + Intronic
948616685 2:239203725-239203747 CTCACCCCCAGCCCTGGCTGGGG + Intronic
948803951 2:240445102-240445124 CCCTCCCCGAGCCTGGCGGGGGG + Intronic
948874457 2:240819553-240819575 CCCTCCCCCACCCCGGGAACCGG + Intronic
1169092978 20:2872747-2872769 CCCTCCCCCGGCCGGGGTTGGGG - Intronic
1169117107 20:3072746-3072768 CCCGCTCCCAGCCTGGGCTGAGG + Intergenic
1169204832 20:3733589-3733611 CCCTGCCCCAGCGCAGGATGGGG + Intronic
1171180248 20:23086130-23086152 TCCTGACCCAGCCCGGGGCGGGG - Exonic
1171959879 20:31485827-31485849 CCCTTCCCCAGGCTGGGGTTGGG - Intergenic
1172109364 20:32536358-32536380 TCTTCCCCCGGCCCTGGGTGGGG - Intronic
1172186261 20:33032882-33032904 CCATCGTCCAGCCCAGGGTGGGG + Intronic
1172411829 20:34730102-34730124 CTGTCCCCCAGGCTGGGGTGTGG + Intronic
1173252212 20:41370034-41370056 CCCTTCCCCAGCCCCAGATGTGG + Intergenic
1173550917 20:43932728-43932750 CCTTCACCCAACCCAGGGTGCGG - Intronic
1173981072 20:47224589-47224611 CCTGACCCCAGCCTGGGGTGTGG + Intronic
1173997274 20:47348036-47348058 TCCTCCCCCAGCCCTGGATAAGG - Intronic
1174315609 20:49698284-49698306 CTGTCCCCCAGGCCGGAGTGTGG - Intronic
1175267244 20:57710108-57710130 CCCTCCCCGAGCCGGGGGGCGGG + Intronic
1175332517 20:58175221-58175243 CCATCCCCCGCCCCAGGGTGTGG + Intergenic
1175521346 20:59604385-59604407 TCCTCCCCCACCCCGGCGCGCGG + Intronic
1175929548 20:62487293-62487315 CCCTCCCCCAGCTCTCAGTGGGG - Intergenic
1175947797 20:62566758-62566780 CCCTCCCACAGGCCCGGGAGTGG - Intronic
1175996759 20:62815422-62815444 CCCACCCCAAGCCCAGGGTCTGG - Intergenic
1176195621 20:63835368-63835390 ACCTCCCCCAGCCCGTGGGTGGG - Intergenic
1176222885 20:63978520-63978542 CCCAACCCCTGCCCTGGGTGTGG - Intronic
1176295402 21:5069532-5069554 CGCTCCACCAGCCCGAGCTGTGG + Intergenic
1176310073 21:5144825-5144847 CCCTTCCCCAGGGCGGGGTTGGG + Intronic
1176428012 21:6560565-6560587 CCCGCCCCCAGCCCCAGGAGGGG - Intergenic
1177945827 21:27468671-27468693 CTGTCCCCCAGGCCGGAGTGCGG - Intergenic
1178162897 21:29939462-29939484 TCCTCGCCCAGCCCGGGCTCTGG - Exonic
1178314539 21:31557996-31558018 CCCTCCCCCCGGCCGCGGGGCGG - Intronic
1179490097 21:41735560-41735582 GCCTGGCCCAGCCCGGGCTGTGG + Intergenic
1179703503 21:43168882-43168904 CCCGCCCCCAGCCCCAGGAGGGG - Intergenic
1179716501 21:43291324-43291346 CCCTCCTCCAGGACGTGGTGTGG - Intergenic
1179846983 21:44117207-44117229 CCCTTCCCCAGGGCGGGGTTGGG - Intronic
1180148220 21:45933864-45933886 CCCTCCCTGGGCCCTGGGTGGGG - Intronic
1180798438 22:18619513-18619535 CCATCCCCCAGCACTGGATGGGG + Intergenic
1181223280 22:21375752-21375774 CCATCCCCCAGCACTGGATGGGG - Intergenic
1181236391 22:21450011-21450033 CCCTTCCGCTGCCTGGGGTGGGG - Exonic
1181324265 22:22032666-22032688 CCCTCCAGCAGCTCAGGGTGAGG - Intergenic
1181647174 22:24238190-24238212 CTGTCCCCCAGGCTGGGGTGTGG - Intronic
1181967945 22:26669694-26669716 CCCGCCCCCACCCAGGGATGGGG + Intergenic
1182074870 22:27488530-27488552 CACCCCCCCCGCCAGGGGTGGGG - Intergenic
1182114621 22:27748959-27748981 CTCTCCCACAGCCCATGGTGGGG + Exonic
1182472713 22:30558456-30558478 CCCTCCCCCAGGCCTGGGCCAGG + Intronic
1182494097 22:30694477-30694499 CCCTCCCCCAACCCAGGCTGGGG - Intronic
1183304497 22:37075166-37075188 CCCTCACCGGGCCCGGTGTGCGG - Exonic
1183401548 22:37608046-37608068 TCCTCCCCCAAACTGGGGTGGGG - Intergenic
1183402207 22:37611155-37611177 CCCTCCCCAACCCAGGGGTAAGG - Intronic
1183508234 22:38220959-38220981 CCCCACTCCTGCCCGGGGTGAGG + Exonic
1183596971 22:38818716-38818738 CCCTTCCCCACCCAGGGGTCGGG + Exonic
1183599005 22:38829287-38829309 CCCCCATCCAGCCCGGGATGAGG + Intronic
1184039162 22:41933200-41933222 TCCTCCCTCAGCCCTGTGTGGGG + Intergenic
1184417427 22:44360447-44360469 CCCTGCTGCAGCCCCGGGTGGGG - Intergenic
1184458904 22:44626143-44626165 CCCTCCCACAGCCTGGGCAGGGG + Intergenic
1184504530 22:44892942-44892964 CCCACCCCCATCCCTGGGTATGG + Intronic
1184649528 22:45913219-45913241 CCCTCCCCCTGCCCGCCTTGGGG - Intergenic
1184732332 22:46377792-46377814 CCCTCCTCCAGCCCCGCCTGAGG + Intronic
1185049160 22:48544728-48544750 CCTCCCCGCAGCCCGGAGTGGGG - Exonic
1185324801 22:50220349-50220371 TCCTCCCCCAGCTCGGGCTGCGG - Exonic
1185377915 22:50490714-50490736 CCCTCCGCATGCCCCGGGTGCGG + Intergenic
1185416150 22:50711677-50711699 CACTCCCCCAGACAGGGGTCAGG - Intergenic
1185420350 22:50731360-50731382 CCCACCCCCACCCCGGGCCGCGG + Intergenic
949779688 3:7672068-7672090 CCCTCCCCTGCCCCGGGGGGAGG + Intronic
950098869 3:10345345-10345367 CCCTCCCCCAGGCTTTGGTGTGG + Intronic
950645573 3:14374656-14374678 CCCTCCCACTCCCCTGGGTGAGG - Intergenic
950869038 3:16213024-16213046 CCCTCCCCTGGCCCCAGGTGAGG - Intronic
952880644 3:37984271-37984293 CCCTCCCCCACCCCGGGTAGTGG + Exonic
953704172 3:45218879-45218901 CCTTGTCCCATCCCGGGGTGTGG + Intergenic
954369137 3:50161095-50161117 CCCCTCCCCAGCCCAGGGTCTGG + Intronic
954375966 3:50194289-50194311 CCCTCCCCCAGCCCAGCGCGCGG - Intronic
954409218 3:50362988-50363010 CAGTCCCCCAGCCCAAGGTGAGG + Intronic
954616489 3:51971359-51971381 CCCTCCCCACTCCAGGGGTGGGG - Intronic
954628539 3:52035951-52035973 GACTCCCCCAGCCCAGGGTCAGG + Intergenic
954633205 3:52057792-52057814 CGCTCCCCCAGTCAGGGATGGGG - Intergenic
954639892 3:52091568-52091590 CCCTCCTCCTTCCCGGGGTTGGG + Intronic
954973384 3:54670770-54670792 CACACCCTCAGCCTGGGGTGTGG + Intronic
955935082 3:64095243-64095265 CCCTCCCCCATCCCAGGTTGTGG - Exonic
959951502 3:112184978-112185000 TTCTCCCCCAGCCCAGGCTGGGG + Intronic
960940402 3:122929404-122929426 CCCACCCCAGGCCCTGGGTGGGG + Intronic
961305623 3:125958075-125958097 CCCCCCCCCAGGGCGGGGCGTGG + Intergenic
964590851 3:158360931-158360953 CCCCCTCACAGCCTGGGGTGGGG + Intronic
966868526 3:184275957-184275979 CCCTCCCCCCACCCCGGGCGGGG + Intronic
968092375 3:195907436-195907458 CTCTGCCCCAGCCCGAGGTGTGG - Intronic
968126410 3:196163723-196163745 CCCTCCTCCTGCCCTGGGCGTGG - Intergenic
968135299 3:196216300-196216322 CCCTGCCCTGGGCCGGGGTGGGG - Intronic
968472571 4:788763-788785 CCTCCCTCCAGCCAGGGGTGTGG + Intronic
968735237 4:2291768-2291790 TCCTCCACCAGCCAGGCGTGTGG - Intronic
968781720 4:2587400-2587422 CCCACCTCCAGCACTGGGTGTGG + Intronic
969112385 4:4852064-4852086 CCACACCCCACCCCGGGGTGGGG + Intergenic
969112387 4:4852069-4852091 TCCTTCCCCACCCCGGGGTGGGG - Intergenic
969378935 4:6782243-6782265 CCCGCCCCCGGCCCGCGCTGGGG - Intronic
969432176 4:7161745-7161767 CCGTCCCCCAGCCCATGGGGAGG - Intergenic
969987054 4:11223341-11223363 CCCTTCCCCAGCAGGGGTTGGGG + Intergenic
971001887 4:22332646-22332668 CCCCCCCCCCCCCCGGTGTGTGG - Intergenic
972740483 4:41882149-41882171 CCCTCCCCCACCCCCGGAGGCGG + Intergenic
974856321 4:67465788-67465810 CCCTGCACCAGCCTGGAGTGTGG + Intergenic
977568789 4:98609350-98609372 CTCTCCCCCAGCCAGTGGTCGGG - Intronic
981614740 4:146634681-146634703 CTATCCCCCACCCCTGGGTGAGG - Intergenic
983100642 4:163622024-163622046 CCCACCCCCAGCCTGATGTGGGG + Intronic
984652957 4:182289191-182289213 CCCTCGCCCAGGCTGGAGTGCGG - Intronic
984778826 4:183505784-183505806 CTCGCCCCCACCCCGGAGTGCGG + Intronic
984824285 4:183910506-183910528 CCCTCCCCCAGCCCTGGGGATGG + Intronic
985749918 5:1667919-1667941 CCCTCTCCCAGCGCAGGATGAGG - Intergenic
986009351 5:3698347-3698369 CCCAGCCCCAGCCCTGGGAGTGG - Intergenic
986176189 5:5354052-5354074 CACTGCCCCAGCCCTGGGAGAGG + Intergenic
986730653 5:10632575-10632597 CCCTCCTCCTGCCCGGGGTTGGG + Intronic
987335318 5:16893595-16893617 CCCTCACCCAGGCTGGAGTGTGG - Intronic
990217771 5:53552958-53552980 TCCTCCCCCTGCTTGGGGTGGGG + Intergenic
992671919 5:79069708-79069730 CCCGCCCCCAGCCCGGGGGGAGG - Exonic
992701548 5:79346105-79346127 CCATCCCCCAGGCTGGAGTGTGG - Intergenic
995279611 5:110318342-110318364 CCCTCCCCCAACCCCGGGATAGG - Intronic
997525747 5:134552188-134552210 CCATCCCAGAGCCCGTGGTGAGG + Exonic
998097230 5:139402978-139403000 CCCTTCCCCAGGCTGGGTTGGGG - Intronic
999393118 5:151208674-151208696 TCTTCCTCCAGCCCAGGGTGGGG - Intronic
999434525 5:151553040-151553062 CCCTCTTTCAGCCCGGAGTGGGG - Intronic
1001240723 5:170067888-170067910 CCCTGCCCCAGCACAGGGTATGG - Intronic
1001398437 5:171432968-171432990 CCCTCACCCAGCCTGGGAGGTGG + Intronic
1001422182 5:171596407-171596429 GCCTCCCCCATCCCTGGATGGGG - Intergenic
1002188510 5:177467133-177467155 CCCGCCCCCAGCGCTGGGTTAGG - Intronic
1002524405 5:179807152-179807174 CCCGCCCCCCGCCCCGGCTGCGG - Intronic
1002696946 5:181098266-181098288 CCTTCCCCCAGCCGCGGGCGAGG - Intergenic
1002697676 5:181101107-181101129 CCTTCCCCCAGCCGCGGGCGAGG + Intergenic
1002709269 5:181184428-181184450 CCCTACCCCAGCGCGGCCTGTGG + Intergenic
1002925774 6:1604993-1605015 CCCTCACCCCGGCCGGGGAGTGG - Intergenic
1005724596 6:28636009-28636031 CCATCCCCCGGCCTGGGCTGCGG + Intergenic
1006042882 6:31270204-31270226 CCTTACCCCAGCTCAGGGTGAGG + Exonic
1006271602 6:32970304-32970326 CCTTCCCCCAGCCAGGGATCAGG - Intronic
1006336817 6:33425327-33425349 CCCTCCCACGGCCCGGCTTGCGG - Intronic
1006411768 6:33877936-33877958 GCCTCCCTCAGCCTGTGGTGTGG - Intergenic
1006582892 6:35086861-35086883 CCCACCCCCAGGCCAGGCTGTGG - Intronic
1006786273 6:36669414-36669436 CCCTCCCCCAACCAGGGCAGGGG - Intergenic
1006908108 6:37546346-37546368 CCCTCCTCCTCCCCGGGGTGAGG + Intergenic
1006950519 6:37818779-37818801 CCCTCCCCCAGCCCCTTGTCTGG - Intergenic
1006952488 6:37835194-37835216 CTCTCTCCCAGGCTGGGGTGCGG + Intronic
1007161094 6:39792421-39792443 CGCTCCCGCAGCCCGAGGTACGG - Intronic
1007168950 6:39848761-39848783 CTCTCCCCCAGCCCTGCCTGAGG + Intronic
1007249165 6:40483969-40483991 CCCTCTCCCTGCCAGGAGTGCGG + Intronic
1007345798 6:41228632-41228654 CCCTTCCCCAGCCTGTGATGGGG + Intronic
1007739371 6:44001509-44001531 GCCTCCAGCAGCCTGGGGTGGGG + Intronic
1007784132 6:44270608-44270630 CCCACCCCCCGCCGGGGGAGGGG - Exonic
1007784135 6:44270609-44270631 CCCTCCCCCGGCGGGGGGTGGGG + Exonic
1008622296 6:53282440-53282462 CCCTTCCCCTCCCCTGGGTGTGG + Intronic
1008885183 6:56424673-56424695 CCCTCCACCAGCCAGGAGTCAGG + Intergenic
1009367064 6:62864033-62864055 CCCCCCCCCACCCCGCGATGTGG + Intergenic
1010043963 6:71420061-71420083 CTCACCCGCAGCCCGAGGTGCGG + Intergenic
1010670070 6:78676366-78676388 CCCTCCCCCAGCCAGGCTTGCGG - Intergenic
1013196297 6:107848057-107848079 CCCTCCCCCAGGACGGGGGTCGG + Intergenic
1014085973 6:117344663-117344685 CCCTCCCCCAACCCAGGAGGCGG + Intronic
1014517745 6:122400033-122400055 CCCTCCCCCACCGCGGCCTGAGG - Intronic
1015174835 6:130295694-130295716 CCCTCTCCCAGACCCAGGTGGGG + Intronic
1016461732 6:144285760-144285782 CCCTTGGCCAGCTCGGGGTGCGG + Intronic
1017164105 6:151391354-151391376 GCCACCCCCAGCCCAGGGTCCGG - Intronic
1017935171 6:158999371-158999393 CCCATCCCCAGGCCGGGGTCTGG - Intronic
1017966464 6:159271108-159271130 CCCAACCCCAGCCTGGGGTGGGG - Intronic
1018949957 6:168372590-168372612 CCATGGCCCAGCCCGGGATGTGG - Intergenic
1018993504 6:168692746-168692768 CCCTCCACAGGCCCGGGGCGGGG + Intergenic
1019395665 7:816570-816592 CCCGCCCTCGGCCCGGGGCGCGG + Intergenic
1019460684 7:1156826-1156848 TCCTGCCCCAGCATGGGGTGGGG - Intronic
1019472646 7:1229684-1229706 CCCTTCCCCCGCCCGGGCCGCGG - Intergenic
1019517098 7:1444927-1444949 GGCTCCCCCACCCTGGGGTGTGG + Exonic
1019928424 7:4208154-4208176 TCCTCCCCGAGCCCGTGGTGAGG + Exonic
1021451086 7:20784667-20784689 CCTTGCCGCAGCCCGGGATGTGG + Exonic
1022094671 7:27131036-27131058 CCCTCCCCCAGCCCAGGGGCCGG - Intronic
1023793581 7:43772485-43772507 CCCTGCCCCAGGGCTGGGTGTGG + Intronic
1023835202 7:44063846-44063868 CCCTCCCACAGCCTGGTTTGGGG - Intronic
1023849345 7:44141426-44141448 GCCTCCCCCAGCCCAGGCGGGGG - Intergenic
1026805021 7:73424073-73424095 CCCTGCCCCAGCCCCGGGCCGGG - Intergenic
1026968300 7:74453936-74453958 CCCACCCCCGGCGCGGGCTGCGG - Intronic
1026968587 7:74454701-74454723 CCCTCCCCGGGGCCGGGGCGGGG - Intronic
1027250843 7:76397827-76397849 CCCGCCCCCATCCCCAGGTGAGG - Exonic
1027266640 7:76498383-76498405 CCCTTCCCCTGCCCTGGGGGAGG + Intronic
1027318021 7:76996501-76996523 CCCTTCCCCTGCCCTGGGGGAGG + Intergenic
1028892109 7:95999885-95999907 CCCTCCCCCAACCCAGATTGTGG + Intronic
1029139657 7:98400908-98400930 CCCTCCCGCTGCCCGGAGTCCGG - Exonic
1029241820 7:99168545-99168567 CTGTCCCCCAGGCTGGGGTGTGG + Intergenic
1029481903 7:100818491-100818513 CCATCCCCCAGCCCTGGGGTGGG - Intronic
1031689160 7:124766179-124766201 CCCGCCCCTAGCCCGGGCTCGGG - Intergenic
1032074838 7:128831416-128831438 CCCTCTCCCAGCCCGCGGAGGGG - Intronic
1032783532 7:135183293-135183315 CCCTGCCCCAGGCAGGGGTCAGG + Intergenic
1033033022 7:137845805-137845827 CCCTCCTCCAGCCAGGAGAGAGG + Intronic
1033435416 7:141329260-141329282 CCCACCCCCTACCTGGGGTGTGG + Intronic
1034090001 7:148354862-148354884 CCCGCCACGAGCCCAGGGTGGGG - Intronic
1034349700 7:150407894-150407916 CCCTTCCCCTGCCCCGAGTGCGG + Intronic
1034444262 7:151104661-151104683 CTCTCCACCAGCCGTGGGTGGGG - Intronic
1035031086 7:155861149-155861171 GCCTCCTCCAGTCCTGGGTGAGG + Intergenic
1035341275 7:158164131-158164153 TCCTCCCACACCCCAGGGTGTGG - Intronic
1035395823 7:158534158-158534180 CCCTGACGGAGCCCGGGGTGTGG - Intronic
1035422508 7:158741454-158741476 CTCTCCCCCAGCGTGGGGTGGGG + Intronic
1035741550 8:1931636-1931658 CCCTCCCTCTGCCCGGGCCGAGG - Intronic
1036482429 8:9150817-9150839 GCCTCCGCCAGCCCGGGACGGGG + Intronic
1036649022 8:10630256-10630278 CCATCCTCCTGCCTGGGGTGTGG - Intronic
1036701245 8:11015478-11015500 CCCTCCCCGAGGTGGGGGTGGGG - Intronic
1036786252 8:11689691-11689713 CCCTGGCCCAGCCAAGGGTGGGG - Intronic
1037374581 8:18213848-18213870 CTCTCGCCCAGGCCGGGGTGCGG + Intronic
1037855354 8:22367459-22367481 CACTGCCCCAGCCTGGGGTGCGG - Intronic
1038799429 8:30735800-30735822 CTGTCCCCCAGGCTGGGGTGCGG - Intronic
1039680531 8:39730501-39730523 CCCCTCCCCAGCCCGGCCTGAGG - Intergenic
1040005665 8:42618792-42618814 CCCTCAGCCAGCCCTGAGTGTGG - Intergenic
1044625377 8:94231525-94231547 ACCTACCCCAGACCTGGGTGTGG + Intergenic
1045137250 8:99234120-99234142 CCCTCAGCGAGCCCAGGGTGGGG - Intronic
1045305032 8:100951339-100951361 CCCTCCCCCACCCCGGGAGGCGG - Intronic
1045571279 8:103371434-103371456 CCCACCCCGAGCCCGGCGTGGGG - Intergenic
1048442475 8:134470025-134470047 TCCCGCCCCAGCCAGGGGTGGGG - Intergenic
1048963736 8:139600236-139600258 CTCGCCCCCAGCCAGGGCTGAGG - Intergenic
1049420071 8:142512534-142512556 CCTTCTCCCAGCCCGGTGTCAGG + Intronic
1049474031 8:142788606-142788628 CCCTCCTCCAGCCCCAGGTGTGG - Intergenic
1049508839 8:143017954-143017976 CCATCCCTCAGGCGGGGGTGGGG - Intergenic
1049791298 8:144473891-144473913 CCCTCCCCCAGCCTGGAGCACGG + Exonic
1049804991 8:144534642-144534664 GCCTCCCCCAGCACTGGCTGCGG - Intronic
1050461035 9:5877555-5877577 CCCTGCCCAAGCCCATGGTGTGG - Intergenic
1052995847 9:34551359-34551381 TCCTCCGCCAGCCCTGGATGGGG + Intergenic
1054870585 9:70044373-70044395 CCCTGGCCAAGCCTGGGGTGGGG + Intronic
1057312017 9:93948773-93948795 CCCTCCCCCATCCCGGGCCGGGG + Intergenic
1057913202 9:99035957-99035979 CCCTCTCCCAGCATTGGGTGAGG - Intronic
1057934158 9:99222454-99222476 GCTTCCCCCAGCCTCGGGTGTGG + Intronic
1058272172 9:102986213-102986235 CCCAGCACCAGCCTGGGGTGTGG + Intergenic
1058890327 9:109355652-109355674 CTGTCCCCCAGGCTGGGGTGTGG + Intergenic
1058908261 9:109498366-109498388 CCCGCCCCCCGCCCGGCGCGCGG - Intergenic
1060599889 9:124870402-124870424 CCCTCCCCCCGCACGGGTGGGGG + Intronic
1060793319 9:126499856-126499878 CCCTCCCCCAGCCCGCGGGCCGG + Intronic
1061182081 9:129030281-129030303 CCCTCTCCCAGCCCTGGTTCTGG + Intergenic
1061237957 9:129352943-129352965 CCCTCTCCCCTCCTGGGGTGGGG + Intergenic
1061268775 9:129524395-129524417 CCCTCTCCCTCTCCGGGGTGGGG - Intergenic
1061498022 9:130986687-130986709 CCCCCCCCCAGCCTGGCCTGAGG + Intergenic
1061625630 9:131839171-131839193 CCCTCACCCAGGCCTGGGAGTGG - Intergenic
1061996550 9:134188991-134189013 CCCTTGCCCAGCCTGAGGTGTGG - Intergenic
1062393268 9:136342486-136342508 CCCTTCCCCAGCCCTGGGGGAGG - Intronic
1062570011 9:137180652-137180674 CACACCCCCAGCCAGGAGTGGGG + Intronic
1185877691 X:3713533-3713555 GCCCCCCCCAGCCCGGGCCGCGG - Exonic
1187128991 X:16482571-16482593 CCCTCCCCCATCAAGAGGTGAGG + Intergenic
1187517603 X:19986838-19986860 CCCTCACCCAGGCTGGTGTGCGG + Intergenic
1188811424 X:34657338-34657360 GCCTCCCGCAGCCCGGGGAGGGG - Intergenic
1189001978 X:36957618-36957640 ACCTCCCGCAGCCTGGGGAGGGG + Intergenic
1189280399 X:39816881-39816903 CCCTCTCCCAGAACGAGGTGAGG - Intergenic
1189354221 X:40299084-40299106 CCCTCCCACAGCCCGGGCGGGGG + Intergenic
1189354226 X:40299089-40299111 CCCCGCCCCCGCCCGGGCTGTGG - Intergenic
1190214449 X:48470326-48470348 CCCACCCCAAGCGTGGGGTGGGG + Intergenic
1192234931 X:69289724-69289746 CTCTCCCCCAGCCTGGGGGAGGG - Intergenic
1193488446 X:82116244-82116266 CCCTCCCCCAGCCCCAGAAGTGG - Intergenic
1193664465 X:84299297-84299319 CCCTCCCCCACCCCCAGCTGTGG + Intergenic
1194247583 X:91534935-91534957 CCCTCCCCCACCCCAGGCTTGGG - Intergenic
1195269303 X:103215024-103215046 CCCTCCTGCAGCCCGGAGTCAGG - Intergenic
1195279003 X:103311052-103311074 CCCTCCTGCAGCCCGGAGTCAGG + Intergenic
1196902519 X:120399837-120399859 CCCTCCCCCACCCAAGGGAGGGG + Intergenic
1197712807 X:129684072-129684094 CCCTCCACCAGCCCGAGGCTCGG + Intergenic
1198389056 X:136155262-136155284 CCCTGGCCCAGCCCAGGGTGGGG - Intronic
1198518138 X:137428541-137428563 TCCACCCCCAGCCCGGGGGGAGG + Intergenic
1199134749 X:144236295-144236317 CCATCCTCCAGCCCAGGCTGTGG - Intergenic
1199628747 X:149761970-149761992 CCCTCGGTCAGCCCGGGATGCGG + Intergenic
1199634905 X:149805571-149805593 CCCTCCATCAGCCCAGGATGTGG - Intergenic
1199894449 X:152117474-152117496 CCCTCCTTCAGCCCTGGATGTGG + Intergenic
1200018044 X:153180482-153180504 CCCTCCATCAGCCCTGGATGGGG - Intronic
1200566605 Y:4776468-4776490 CCCTCCCCCACCCCAGGCTTGGG - Intergenic
1201773779 Y:17643333-17643355 CCCACCCAAAGCCTGGGGTGTGG + Intergenic
1201787310 Y:17799321-17799343 CCCTCCTCCAGCCCAGGATTGGG - Intergenic
1201814243 Y:18106667-18106689 CCCTCCTCCAGCCCAGGATTGGG + Intergenic
1201827778 Y:18262656-18262678 CCCACCCAAAGCCTGGGGTGTGG - Intergenic