ID: 1161344579

View in Genome Browser
Species Human (GRCh38)
Location 19:3761682-3761704
Sequence CCGCGCATGCTCAATGGGCC AGG (reversed)
Strand -
Crispr in exon? Yes
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 52
Summary {0: 1, 1: 0, 2: 1, 3: 5, 4: 45}

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1161344579_1161344585 -4 Left 1161344579 19:3761682-3761704 CCTGGCCCATTGAGCATGCGCGG 0: 1
1: 0
2: 1
3: 5
4: 45
Right 1161344585 19:3761701-3761723 GCGGCCTCGCGAGGCCTGCTGGG 0: 1
1: 0
2: 0
3: 9
4: 104
1161344579_1161344588 30 Left 1161344579 19:3761682-3761704 CCTGGCCCATTGAGCATGCGCGG 0: 1
1: 0
2: 1
3: 5
4: 45
Right 1161344588 19:3761735-3761757 TCCCACCCAGCCTCGCCACGCGG 0: 1
1: 0
2: 1
3: 23
4: 205
1161344579_1161344584 -5 Left 1161344579 19:3761682-3761704 CCTGGCCCATTGAGCATGCGCGG 0: 1
1: 0
2: 1
3: 5
4: 45
Right 1161344584 19:3761700-3761722 CGCGGCCTCGCGAGGCCTGCTGG 0: 1
1: 0
2: 1
3: 9
4: 141

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1161344579 Original CRISPR CCGCGCATGCTCAATGGGCC AGG (reversed) Exonic
900660132 1:3778003-3778025 CCACGGGTGCTCATTGGGCCAGG + Intergenic
902560138 1:17272216-17272238 CCGAGCATGCGCAAAGGCCCGGG + Intronic
909685242 1:78340555-78340577 CTGAGCATGCACAATGTGCCAGG - Intronic
1066094141 10:32056446-32056468 CTGCGCAGGCGCAGTGGGCCAGG + Intergenic
1077386342 11:2271165-2271187 ACGCGCTTCCTCAATGGGGCCGG - Intergenic
1101731651 12:107431888-107431910 CGGCCCATGTTCCATGGGCCAGG - Intronic
1103595369 12:122021874-122021896 CGGCGCTTGCGCACTGGGCCAGG + Exonic
1107364446 13:39655619-39655641 CCGCGCATGCGCATCGGCCCCGG - Intronic
1114556935 14:23567535-23567557 CCGCGCATGCTCAATAGGAAGGG - Exonic
1119728336 14:76935735-76935757 CAGTGCCTGCTCCATGGGCCTGG + Intergenic
1122288725 14:100668092-100668114 CCAGGCATGCACAGTGGGCCTGG + Intergenic
1124214956 15:27798686-27798708 ACGGGCATCTTCAATGGGCCTGG - Intronic
1124453835 15:29822482-29822504 CCGGGCATGCTCAGTGGGCCGGG - Exonic
1130838236 15:87672681-87672703 CCTAGCATGCTCAATAGGCCAGG + Intergenic
1134098373 16:11434681-11434703 CTGAGCATGCTCACTGGCCCTGG + Intronic
1142884297 17:2903274-2903296 CAGCTCCTCCTCAATGGGCCTGG - Intronic
1145992894 17:29089879-29089901 CCGCGCATGCTCAGCAGGGCTGG - Intronic
1147722396 17:42547189-42547211 CCCCTCATGCTCCAGGGGCCTGG - Intergenic
1150823833 17:68457482-68457504 CCGCGCCGGCTCCACGGGCCGGG + Intronic
1157749575 18:50166106-50166128 CCCCGCCTGCTCAATGGTGCTGG - Intronic
1159770950 18:72544387-72544409 CCGCGCTCGCTCAAAGGACCCGG + Exonic
1160824918 19:1074988-1075010 CCGCGCATGCGCAGGAGGCCGGG - Intronic
1161344579 19:3761682-3761704 CCGCGCATGCTCAATGGGCCAGG - Exonic
1167262880 19:48469026-48469048 CTGCGCCTGCTCAAAGGCCCTGG - Exonic
1167469176 19:49665959-49665981 CCGCGCCTGCGCACTGGGCCGGG - Exonic
1167517054 19:49929552-49929574 CTGCGCATGCGCACTGGGCCCGG + Intronic
927512688 2:23654279-23654301 CCGGGGATGCTAACTGGGCCAGG - Intronic
930209294 2:48617836-48617858 CCGCGCAGGCGCAAAGGGCCAGG + Exonic
940650292 2:156435415-156435437 CTGGGCATGCTCAGTGGGCAGGG + Intronic
947813833 2:233022896-233022918 CCTCGCATCCTAATTGGGCCAGG + Intergenic
947992347 2:234497272-234497294 CCGCGCAGACACAATGGGCGCGG + Intergenic
949008665 2:241666150-241666172 CCGGGCATGCTCCATGCTCCCGG + Intronic
1170889899 20:20368173-20368195 CCGCGCCCGGGCAATGGGCCGGG + Exonic
1173550951 20:43932855-43932877 CCGTGCATCCTCCAGGGGCCTGG + Intronic
1183258186 22:36776519-36776541 CGGCGCCTGCGCAGTGGGCCAGG + Intergenic
1185075640 22:48680654-48680676 CCTGGCATGCACAAGGGGCCTGG - Intronic
950453976 3:13081776-13081798 CCGCCCAAGGTCACTGGGCCAGG - Intergenic
953773442 3:45796405-45796427 CCGCGCTTTCTCCATGGCCCCGG + Exonic
959813076 3:110642191-110642213 TCGGGCATGCTGAATGGCCCAGG + Intergenic
961718942 3:128879422-128879444 CCGCGCAAGCGCAGTGGGGCCGG + Intergenic
968506518 4:973573-973595 CCGCGCCTGCGCAGTGGGGCAGG - Intronic
968796992 4:2713480-2713502 CCACTCATGCTCCTTGGGCCTGG + Intronic
988688541 5:33549253-33549275 CAGCTCATGCTCAATGGGGGAGG + Exonic
1018420167 6:163634265-163634287 CAGCGCCTGCTCAAAAGGCCTGG - Intergenic
1018702555 6:166438600-166438622 CCGCACAAGCTCAGTGGGGCTGG - Intronic
1020192309 7:6009515-6009537 CCGCGCGTGCGCACTGGGCGGGG - Intronic
1023827506 7:44019369-44019391 CGGCGCATGCTCAGAGCGCCGGG + Intergenic
1026745098 7:73005537-73005559 CCGCGCGTGCGCAGTGGGCGGGG + Intergenic
1027031210 7:74890232-74890254 CCGCGCGTGCGCAGTGGGCGGGG + Intergenic
1027098642 7:75359543-75359565 CCGCGCGTGCGCAGTGGGCGGGG - Intergenic
1029399741 7:100336355-100336377 CCGCGCGTGCGCAGTGGGCGGGG - Intronic
1185610526 X:1391688-1391710 CCACGCGTGCGCACTGGGCCCGG - Intronic