ID: 1161345910

View in Genome Browser
Species Human (GRCh38)
Location 19:3768610-3768632
Sequence TAGGGGACTCTGGAGTGGAG GGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1161345898_1161345910 9 Left 1161345898 19:3768578-3768600 CCGTCTCAGGGAAACCCTAACCT No data
Right 1161345910 19:3768610-3768632 TAGGGGACTCTGGAGTGGAGGGG No data
1161345900_1161345910 -5 Left 1161345900 19:3768592-3768614 CCCTAACCTTCATCCTCTTAGGG No data
Right 1161345910 19:3768610-3768632 TAGGGGACTCTGGAGTGGAGGGG No data
1161345897_1161345910 10 Left 1161345897 19:3768577-3768599 CCCGTCTCAGGGAAACCCTAACC No data
Right 1161345910 19:3768610-3768632 TAGGGGACTCTGGAGTGGAGGGG No data
1161345902_1161345910 -6 Left 1161345902 19:3768593-3768615 CCTAACCTTCATCCTCTTAGGGG No data
Right 1161345910 19:3768610-3768632 TAGGGGACTCTGGAGTGGAGGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1161345910 Original CRISPR TAGGGGACTCTGGAGTGGAG GGG Intergenic
No off target data available for this crispr