ID: 1161350562

View in Genome Browser
Species Human (GRCh38)
Location 19:3789073-3789095
Sequence CACCCACAGCTTCGTGGATC TGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 96
Summary {0: 1, 1: 0, 2: 0, 3: 9, 4: 86}

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1161350560_1161350562 -5 Left 1161350560 19:3789055-3789077 CCGTGTCTACAATTTTAGCACCC 0: 1
1: 0
2: 2
3: 9
4: 106
Right 1161350562 19:3789073-3789095 CACCCACAGCTTCGTGGATCTGG 0: 1
1: 0
2: 0
3: 9
4: 86
1161350559_1161350562 -4 Left 1161350559 19:3789054-3789076 CCCGTGTCTACAATTTTAGCACC 0: 1
1: 0
2: 0
3: 10
4: 114
Right 1161350562 19:3789073-3789095 CACCCACAGCTTCGTGGATCTGG 0: 1
1: 0
2: 0
3: 9
4: 86

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1161350562 Original CRISPR CACCCACAGCTTCGTGGATC TGG Intronic
902618018 1:17634554-17634576 CAACCACAGGTACGTGGTTCAGG + Exonic
902849132 1:19139852-19139874 CAGCCACAGCATCCAGGATCAGG + Intronic
906130559 1:43453078-43453100 CTCCCACAGCTTCCTGGAATAGG + Intronic
906294855 1:44643433-44643455 GACCCAGATCTTCATGGATCTGG + Intronic
909239263 1:73191551-73191573 TACCCACACCTTAGTGGTTCTGG + Intergenic
914936376 1:151984414-151984436 CACCCTCAGCTTCCTGGCTGTGG + Intronic
1065718953 10:28606130-28606152 CAGCCACGACTTCGTGGCTCAGG + Intronic
1067860595 10:49843558-49843580 CACTCCCATCTTCGTGGCTCCGG + Exonic
1069597182 10:69679840-69679862 CACCCACTGCTTTGGGGCTCTGG + Intergenic
1072640278 10:97206414-97206436 CACCCACAGGCTCTGGGATCTGG + Intronic
1083213884 11:61206574-61206596 CACCCACAGGTTGGAGGAGCCGG - Exonic
1083216768 11:61225403-61225425 CACCCACAGGTTGGAGGAGCCGG - Exonic
1083219650 11:61244229-61244251 CACCCACAGGTTGGAGGAGCCGG - Exonic
1083661915 11:64255392-64255414 CAGCTTCAGCTTCGTGTATCTGG - Exonic
1084018659 11:66403534-66403556 CAGCCATGGCTTGGTGGATCAGG - Intergenic
1084470209 11:69355067-69355089 CACCCACAGCTTCATCGAGGTGG - Intronic
1097645675 12:62233580-62233602 CACACACAGCCTCGTGGGTAGGG - Intronic
1104878271 12:132051832-132051854 CACCCACTACTTAGTGGACCGGG - Intronic
1106353578 13:28957662-28957684 CACCCACAGATTTTTGTATCTGG + Intronic
1112297636 13:98202247-98202269 CTCCAACAGCTCCGTGCATCTGG - Intronic
1115376400 14:32681758-32681780 CAGCCACAGCTTCTTGGCTCAGG + Intronic
1120775963 14:88438577-88438599 ATCCCACAGTTTTGTGGATCAGG + Intronic
1121674066 14:95738240-95738262 CACCCACAGGTTCTTGGAGGTGG - Intergenic
1128520744 15:68373147-68373169 CACCGACGGCTTCCTGGAGCAGG - Intronic
1129059707 15:72851048-72851070 CACCCACAGCTCACTGGACCAGG - Intergenic
1134829467 16:17311575-17311597 CACCCACAGTCCCATGGATCTGG - Intronic
1144044989 17:11447438-11447460 CCCCCACAGCTTCCCGGAACTGG + Intronic
1144708411 17:17384852-17384874 CACCCACAGCTTCGTGGGCTGGG - Intergenic
1146369447 17:32256223-32256245 CAACCACAGCTTCAAGGTTCCGG + Intergenic
1147009245 17:37431255-37431277 CTCCCACAGTTTTGTGGGTCAGG + Intronic
1149549786 17:57531862-57531884 CACCCACAGCAACAGGGATCTGG - Intronic
1151404620 17:73878368-73878390 CTCCCACAGCTCTGTGGAACAGG + Intergenic
1152616703 17:81341308-81341330 CAGCGACAGCTTCGGGGAGCGGG - Intergenic
1157426059 18:47585148-47585170 CACCCACAGCACCCTGGGTCTGG + Intergenic
1158539427 18:58339362-58339384 CACAAAGAGCTACGTGGATCCGG - Intronic
1161350562 19:3789073-3789095 CACCCACAGCTTCGTGGATCTGG + Intronic
1162497505 19:11031595-11031617 CACCCACTGCTTGGTGGAAGAGG - Intronic
1162943494 19:14028375-14028397 CACCCATAGCCTCGTGGGCCAGG - Exonic
1164608854 19:29618677-29618699 CACCCACAGCTGCCTAGAGCCGG - Intergenic
927961124 2:27241253-27241275 CACCCAGAGCTTTGAGGATTTGG + Intronic
932289502 2:70564504-70564526 CACCTACAGCTTGGAGAATCTGG + Intergenic
932669068 2:73720968-73720990 AACCCAAAGGTGCGTGGATCTGG + Intergenic
934654496 2:96110156-96110178 CACCCACAGCAACCAGGATCTGG + Intergenic
937261045 2:120587048-120587070 CATCCCCAGCTCCGTGGCTCCGG + Intergenic
946488317 2:220122344-220122366 TACCCACACATTAGTGGATCAGG - Intergenic
948335220 2:237202118-237202140 CACCCACAGCTTCTTGGTTATGG - Intergenic
948460416 2:238127548-238127570 GACCCAGAGCCTCGGGGATCCGG - Intronic
948658019 2:239488845-239488867 CACACACAGATTTGTGGATTTGG - Intergenic
948846201 2:240683892-240683914 TACCCACAGCTGCGTGGAGAAGG + Intergenic
948847656 2:240690836-240690858 TACCCACAGCTGCGTGGAGAAGG - Intergenic
949017646 2:241722394-241722416 CACCCACAGCACCGGGGTTCTGG - Intronic
1170559236 20:17541812-17541834 CACTCACAGCTCTGTGGCTCTGG - Intronic
1171414524 20:24968580-24968602 CACCCTCACCATCGTGGCTCTGG - Intronic
1174560770 20:51429213-51429235 CACCCACATCTTGGTGGCTACGG + Intronic
1175190887 20:57211493-57211515 TACCCACAGCTTCCTGGGTCAGG - Intronic
1175190898 20:57211531-57211553 TACCCACAGCTTCTGGGATCAGG - Intronic
1175620977 20:60447340-60447362 TACCCACAGAGTCCTGGATCAGG - Intergenic
1175891383 20:62317543-62317565 CGCCCTCAGGGTCGTGGATCAGG - Intronic
1178690604 21:34746682-34746704 CACCCCCAGTTTCATGGATAAGG - Intergenic
1180611581 22:17101694-17101716 CACCCACAGCTTCTTGTCCCCGG - Intronic
1182379121 22:29872225-29872247 TCCCTACAGCTTCATGGATCTGG + Intergenic
1183364100 22:37398164-37398186 CGCCCACAGCTGCCTGGCTCTGG - Intronic
1185273917 22:49941762-49941784 CCCACACACCTTCGTGGTTCTGG - Intergenic
959304733 3:104647359-104647381 CATTGACAGCTTTGTGGATCAGG - Intergenic
961827203 3:129605406-129605428 CACCGCCTGCTTCGTGGAACCGG - Exonic
962045431 3:131754724-131754746 GACCCATAGCTTCGTGGCACAGG - Intronic
968602600 4:1517397-1517419 CACCCACACCATGGTGGCTCTGG + Intergenic
979856416 4:125638871-125638893 CACCCTCAGCTTGGTGGACAGGG - Intergenic
985815478 5:2125116-2125138 AACCCACAGCCTCCCGGATCTGG - Intergenic
986130206 5:4923155-4923177 GCCCCACAGCTTCCTGGATGTGG - Intergenic
990672725 5:58150684-58150706 CACACACAGCTTGGTCGATTGGG + Intergenic
992902399 5:81310988-81311010 CACCCACTGCTTCTTGCACCTGG - Intronic
993307433 5:86289959-86289981 GCCCCACAGCAACGTGGATCCGG + Intergenic
997197379 5:131989047-131989069 CACCCACAGCCTTCTGGACCAGG + Intronic
997789998 5:136750381-136750403 CACCCCAAGCTTCCTGGATCAGG + Intergenic
998880396 5:146639518-146639540 CACCCAGAGCTTGGGGGATCAGG + Intronic
1004753352 6:18585802-18585824 CAACCTCAGCTTAGAGGATCAGG - Intergenic
1017253731 6:152309927-152309949 CAACCACATCCTCGGGGATCCGG + Exonic
1018308907 6:162488431-162488453 GACCCACACCTTAGTGGATGTGG - Intronic
1018981121 6:168602620-168602642 CACCCACAGCCACGTGGAGCAGG + Intronic
1019148559 6:169989053-169989075 AACCCAGAGGTTCCTGGATCTGG + Intergenic
1019733510 7:2639647-2639669 CACCCCCGGCTTCCTGGATGGGG - Intronic
1029524705 7:101087738-101087760 CACCCACCGCGTGGTGGACCTGG + Exonic
1032524704 7:132571236-132571258 CACCCACACCTTTTTGCATCAGG + Intronic
1032649055 7:133857845-133857867 CACCCACAGCTCGGCGGATCGGG + Intronic
1036569552 8:9968090-9968112 CAACCACAGCTGGTTGGATCAGG - Intergenic
1036773008 8:11591967-11591989 CAGCCACAGCGTCGGGGAGCAGG + Intergenic
1038446780 8:27610157-27610179 CAGACACAGCTTCGTGGAGGAGG + Intronic
1039745597 8:40423295-40423317 CATCCTCAGCATCATGGATCAGG - Intergenic
1046578706 8:116064894-116064916 CACTTTCAGCTTCTTGGATCTGG - Intergenic
1053268374 9:36732643-36732665 CACCCACAGCTTGCTGGTCCAGG - Intergenic
1061681537 9:132244930-132244952 GGCCCCCAGCCTCGTGGATCCGG - Intergenic
1062286472 9:135775189-135775211 CACCCACAGCCACGTTGCTCGGG - Intronic
1186473539 X:9839349-9839371 CACCCACATCTCCCTGGGTCTGG + Intronic
1191191964 X:57677297-57677319 CAACCACAGCCTCGTCGTTCTGG - Intergenic
1192329112 X:70159972-70159994 CACCCCCACCTCCCTGGATCTGG - Intronic