ID: 1161351019

View in Genome Browser
Species Human (GRCh38)
Location 19:3791730-3791752
Sequence CAGATTATGACAGCCAGAGG GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 180
Summary {0: 1, 1: 0, 2: 0, 3: 16, 4: 163}

Found 0 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1161351019 Original CRISPR CAGATTATGACAGCCAGAGG GGG (reversed) Intronic
901709635 1:11103641-11103663 CAAATTATCAAAGGCAGAGGAGG - Intergenic
901901189 1:12364415-12364437 CAGTTCATGATAGCCAAAGGTGG - Intronic
905452483 1:38065548-38065570 CAGCTTCTGACAGGCAGAGCTGG - Intergenic
906725261 1:48039898-48039920 CAGATGAGGAAAGCCAGTGGGGG + Intergenic
906887746 1:49670023-49670045 CAGAATATGACATCCTGAAGTGG + Intronic
907655089 1:56334029-56334051 CAGAACATCATAGCCAGAGGGGG - Intergenic
907896959 1:58701165-58701187 TAGATACTGACAGCCAGATGCGG + Intergenic
909089666 1:71209478-71209500 CAGGAAATGACAACCAGAGGAGG - Intergenic
909606956 1:77517279-77517301 CCGATTCTGACATGCAGAGGTGG + Intronic
909706338 1:78589169-78589191 CAGATTATCATAGACAGAGTGGG + Intergenic
909765930 1:79355743-79355765 CAGCTTATGACTGCTAAAGGGGG + Intergenic
911601038 1:99848752-99848774 GAGATTAGGACAGACAGATGGGG - Intergenic
912012358 1:104983153-104983175 AAGATTATGACAGACACAGGTGG - Intergenic
914506567 1:148295086-148295108 TGGATTGTGACAGCCAGGGGGGG - Intergenic
915013803 1:152714456-152714478 CAGAATATCATAGCCAGAAGGGG + Intergenic
916340128 1:163724333-163724355 CAGATTATGACATCCAGCTGGGG + Intergenic
919717513 1:200794684-200794706 CAGATTAAGGCAGGCACAGGAGG - Intronic
920786152 1:209043389-209043411 CATATTTTGACAGTCAGAGATGG + Intergenic
921989421 1:221348359-221348381 TAGATTGTGTCAGCCAGAGGAGG - Intergenic
922290863 1:224207956-224207978 CAGTTCATGACAGCCTCAGGAGG - Intergenic
1063092225 10:2875298-2875320 CAGGGTATCAGAGCCAGAGGAGG + Intergenic
1063256414 10:4332182-4332204 CAGTTTCTGCCAGTCAGAGGTGG + Intergenic
1065761109 10:28984154-28984176 CAGATGATAACAGCAAGAGATGG + Intergenic
1065871296 10:29958595-29958617 AATATTATGATAGCCAGAGATGG - Intergenic
1066156147 10:32680177-32680199 CAGATTATGGGAGACAGAGGTGG + Intronic
1070968844 10:80547299-80547321 CATATTATGACAGCAAGACTAGG - Intronic
1072327378 10:94311732-94311754 TAGATGAGGACAGACAGAGGTGG - Intronic
1073621938 10:105059091-105059113 TAGATTTTGAGAACCAGAGGAGG + Intronic
1075462160 10:122624072-122624094 CAGAGTGAGTCAGCCAGAGGTGG + Intronic
1076258866 10:129050207-129050229 CAGATCATGACAGCCCCAGCTGG - Intergenic
1076335004 10:129701008-129701030 CAGGTTCTGGAAGCCAGAGGAGG + Intronic
1076704108 10:132291891-132291913 CTGATGCTGACAGCGAGAGGTGG + Intronic
1076825923 10:132968103-132968125 CACATTGTCACAGCCAGAGCTGG - Intergenic
1079117308 11:17648238-17648260 CTCATTATTACAGCCAGAGATGG + Intergenic
1079952769 11:26824743-26824765 CAGAATAAGACAGCAAGATGAGG - Intergenic
1081492267 11:43578006-43578028 AAGATTATCAGAGGCAGAGGGGG + Intronic
1081557305 11:44176955-44176977 ATGATTATGACAGTGAGAGGTGG + Intronic
1082255692 11:50029820-50029842 CGTATGATGACATCCAGAGGTGG - Intergenic
1085084341 11:73656802-73656824 CAGATTAAAACATCCAGAGGTGG - Intronic
1088390528 11:109309486-109309508 CTGCTTATGTCAGCCAGAGTTGG + Intergenic
1088993517 11:114975434-114975456 CAGTATATGACATCCATAGGAGG + Intergenic
1089559550 11:119336951-119336973 CAGACGATCACAGGCAGAGGTGG - Exonic
1089642679 11:119858102-119858124 CACATAATGACAGCAGGAGGAGG - Intergenic
1095947485 12:47761708-47761730 CATTTAATGACAGTCAGAGGAGG - Intronic
1100790917 12:98128921-98128943 CACATTACAACAGTCAGAGGAGG + Intergenic
1101380656 12:104211401-104211423 CAGATTATAAGAGAGAGAGGAGG + Intergenic
1102193737 12:111009108-111009130 CAGAATAACACAGCCAGAGCTGG - Intergenic
1103627340 12:122230029-122230051 CAGCTGATGACTGCCTGAGGTGG + Exonic
1104417464 12:128607158-128607180 AAGATTATTCCAGGCAGAGGAGG + Intronic
1104519567 12:129460987-129461009 CTGATACTGGCAGCCAGAGGTGG + Intronic
1105917122 13:24926960-24926982 CATATTCTGCCATCCAGAGGAGG - Intergenic
1107052048 13:36061218-36061240 CAGTTTAAGAAAGCCAGAGTGGG - Intronic
1107470424 13:40686458-40686480 CAGATTTTAAAAGCAAGAGGTGG - Intergenic
1108997694 13:56755622-56755644 CAGATTGTGACAGAAAGAGAAGG + Intergenic
1112711338 13:102132406-102132428 CAGCTAATGACAGACAGATGTGG + Intronic
1112833603 13:103485142-103485164 CAGATTATGTCAGTCATAAGAGG - Intergenic
1117584801 14:57190307-57190329 TACATATTGACAGCCAGAGGGGG - Intergenic
1117634088 14:57724089-57724111 CAGAGTATCACACCCAGATGAGG - Intronic
1119418428 14:74491937-74491959 CAGACTCTTACAGCCAGAGGCGG - Intronic
1119958717 14:78830022-78830044 CAGTTTCAGATAGCCAGAGGGGG + Intronic
1120204634 14:81574461-81574483 CAGCATATGAAAGCCAGAGGTGG - Intergenic
1121670416 14:95706169-95706191 CAGGCTTTGACAGGCAGAGGTGG + Intergenic
1127810291 15:62559888-62559910 AAGATTAGGACAGCCACAGAAGG - Intronic
1130097897 15:80869882-80869904 CAGCTGATGAGAGCCAGAGTTGG + Intronic
1131115450 15:89792411-89792433 CAGATGAAGACTGGCAGAGGAGG + Intronic
1132372127 15:101306496-101306518 CACATTCTGACAGCCAGGAGAGG - Intronic
1132376329 15:101330473-101330495 CAGAGTATGGAAGCCAAAGGAGG - Intronic
1140202972 16:72909403-72909425 CAGCATATCACTGCCAGAGGAGG - Intronic
1140667221 16:77238745-77238767 CATATTATGACAGCCCTACGTGG - Intergenic
1142930823 17:3282684-3282706 CTGATTATCACTGACAGAGGTGG + Intergenic
1147878588 17:43639313-43639335 CAGATGAGGAAAGCCAGAAGAGG + Intergenic
1148505342 17:48122624-48122646 CAGGGTAGGATAGCCAGAGGAGG - Exonic
1150996220 17:70320788-70320810 GAGAGTATGACAGCAAGGGGTGG + Intergenic
1151085804 17:71379195-71379217 CAGATTAGGAAAGCAAGCGGGGG + Intergenic
1152553838 17:81043277-81043299 CCGACTATGTCTGCCAGAGGAGG + Intronic
1153637871 18:7128649-7128671 CAGATGATGAAACCCAGAAGTGG + Intergenic
1154074633 18:11188245-11188267 CAGATGATGGCAGTAAGAGGTGG + Intergenic
1154251741 18:12750663-12750685 CAGAGTATGACAGGCAGATGTGG - Intergenic
1155988869 18:32258772-32258794 GAGATCATCACAGCCTGAGGAGG + Intronic
1156714262 18:39987779-39987801 CAGATTATGACACTCACAGTAGG + Intergenic
1159744465 18:72213802-72213824 CAGAATATGATACCCAGAAGTGG - Intergenic
1161351019 19:3791730-3791752 CAGATTATGACAGCCAGAGGGGG - Intronic
1161749886 19:6087962-6087984 CAGCTTATGGCAGCCAGGAGTGG - Intronic
1163203050 19:15782068-15782090 CAAATGATGGCATCCAGAGGAGG + Intergenic
1166287165 19:41838344-41838366 CAGATTGTGACAGGCAGGGTGGG - Intronic
1167787457 19:51647396-51647418 CTGATGTTGACAGCCAGATGAGG + Intergenic
1168376619 19:55885334-55885356 CAGGTTATGAGAGACAGAGGTGG - Intergenic
926041602 2:9677762-9677784 GAGATTATAACAGCCAGGTGCGG - Intergenic
927863586 2:26575372-26575394 CAGAATGTGGGAGCCAGAGGAGG + Intronic
929247683 2:39720468-39720490 CAGAATAAGCCAGGCAGAGGAGG - Intergenic
929489151 2:42381150-42381172 CAGATTAGGAGAGTCAAAGGTGG - Intronic
932515597 2:72345016-72345038 CAGCTTATGGGAGCCAGAGTGGG - Intronic
935888629 2:107651126-107651148 CATATTTTTACAGCCAGACGGGG - Intergenic
937929904 2:127195938-127195960 TAGATTAGGGCAGCCAGAGTGGG - Intronic
938994840 2:136667400-136667422 CTGATTCTGTCAGCCAGGGGTGG + Intergenic
940355103 2:152732707-152732729 CAGATTTTGGTATCCAGAGGGGG - Intronic
944215965 2:197255816-197255838 CAGATAATGAAAGCCAGAGCAGG + Intronic
944863783 2:203840732-203840754 GAGATGATGGCAGCCAGAGCTGG + Intergenic
945991375 2:216398161-216398183 CAGAGCAAGACAGCAAGAGGGGG - Intergenic
946115103 2:217454316-217454338 CAGATTATGACAAAAAGGGGAGG - Intronic
947357969 2:229316527-229316549 CAGGTTATGATAGCTAGAGCAGG + Intergenic
947529454 2:230899509-230899531 CAGATTCTGTCTGCCAGCGGGGG - Intergenic
947973889 2:234347362-234347384 CTGGTCATGACAACCAGAGGAGG + Intergenic
1171985425 20:31657280-31657302 CAGACTTTGACAGGCTGAGGCGG - Intergenic
1172155767 20:32823199-32823221 CAGAATGTGACAGCCAGAAGAGG - Intronic
1173633362 20:44532906-44532928 CAGATTATGAGAGTTGGAGGGGG + Intronic
1173948631 20:46972469-46972491 CAGCTAATGACAGGCAGAGCCGG - Intronic
1177691869 21:24520942-24520964 CAGGCTATGACATACAGAGGAGG - Intergenic
1178561904 21:33645712-33645734 CAGAATCAGACAGCTAGAGGTGG + Intronic
1178731740 21:35110031-35110053 CAAATGGTGACAGCCAGCGGTGG + Intronic
1183132256 22:35849953-35849975 CAGAGAATGACAGCCAGGGAAGG + Intronic
1183474333 22:38027532-38027554 CAGAATAGCACAGCGAGAGGAGG - Intronic
949152310 3:784365-784387 CAGAATATGACAGGAAGAGAAGG + Intergenic
949557097 3:5164021-5164043 CAGATTTTGATATACAGAGGGGG - Intronic
950129548 3:10532554-10532576 CAGCTTTTGACAGGCATAGGTGG - Intronic
950219437 3:11183335-11183357 CAGTTTTTGTTAGCCAGAGGTGG + Intronic
955532701 3:59890891-59890913 CAGATTATGAGAGCCAGTGTTGG - Intronic
958999898 3:100951358-100951380 CATGTTATGAGGGCCAGAGGAGG - Intronic
960630974 3:119729968-119729990 AAGATTATGCCAGGCAGATGGGG - Intronic
960684196 3:120280619-120280641 CAGCTTATGAAGGCCACAGGAGG - Intronic
961062917 3:123847260-123847282 CAGATTTTGACACCCAAGGGAGG + Intronic
961424471 3:126834418-126834440 CTGCTTATGATAGCCAGAGCTGG - Intronic
961980413 3:131072310-131072332 CAGATGATCACATGCAGAGGTGG + Intronic
964056948 3:152472610-152472632 AAGATTATCCCAGGCAGAGGAGG + Intergenic
969887560 4:10229176-10229198 CAGTTTATGACAGCCAGCTCAGG - Intergenic
970288642 4:14547851-14547873 GATAATATGACCGCCAGAGGAGG - Intergenic
972203940 4:36748102-36748124 CAGAGGAGGACAGCCAGAGCAGG + Intergenic
973662236 4:53119962-53119984 CTGGTTATGACAGGCAGAGGAGG - Intronic
975389773 4:73802562-73802584 CTGATTATGTCAGTCAGTGGTGG + Intergenic
975531068 4:75399893-75399915 CAGATTAAGACAGCAAGACAGGG + Intergenic
984697019 4:182789310-182789332 TAGATTATGACGGACAGGGGAGG + Exonic
985334809 4:188880656-188880678 CATATTGTGACAGCCAGAATAGG + Intergenic
987906453 5:24083720-24083742 CAGAGTAGTACACCCAGAGGAGG - Intronic
988690098 5:33563286-33563308 CAGCTTCTGTCATCCAGAGGTGG + Intronic
989078022 5:37585785-37585807 GAGATTATGACAGGCAGGGCAGG - Intronic
992045349 5:72882810-72882832 TAGATTATACCAGCCAGTGGAGG + Intronic
993641979 5:90416723-90416745 AAGACTTTGACAGGCAGAGGCGG - Intergenic
996097723 5:119416575-119416597 TAGCTTATGACGGCCAGATGGGG + Intergenic
997968421 5:138379612-138379634 CAAAATATATCAGCCAGAGGGGG + Exonic
998499110 5:142616622-142616644 GAGAGTAAGAGAGCCAGAGGTGG - Intronic
1002347405 5:178557562-178557584 CAGATAAGGAAGGCCAGAGGAGG - Intronic
1003026054 6:2556744-2556766 CAGAGTCTGACAGCCACTGGAGG + Intergenic
1003309910 6:4961607-4961629 CATAGTAAGCCAGCCAGAGGAGG - Intergenic
1004085974 6:12449638-12449660 CAGAAGATGACAGACAGAAGAGG + Intergenic
1012461642 6:99469397-99469419 CAGATTATGACAGTAGGATGAGG + Intronic
1015074525 6:129139558-129139580 CAGATTTTGATATCCACAGGAGG + Intronic
1015235787 6:130969462-130969484 CAGATTCTGACATCCAGACTTGG - Intronic
1016481829 6:144490155-144490177 GAGAGTAGGACTGCCAGAGGAGG + Exonic
1019233424 6:170587511-170587533 ACGATTATGACAGCCTCAGGAGG + Intergenic
1020215561 7:6187442-6187464 CAGATGATGACTTACAGAGGAGG + Intronic
1020447247 7:8282246-8282268 CAGAGTATGACACCCAAAGGTGG - Intergenic
1023694804 7:42833989-42834011 AAGATTTTGAATGCCAGAGGGGG + Intergenic
1024041460 7:45559244-45559266 CAGATTATGGCAGTGAGAGAAGG + Intergenic
1024979438 7:55145135-55145157 CAGGCAATGACTGCCAGAGGAGG - Intronic
1026810923 7:73464005-73464027 CAAATTAAGAAAGACAGAGGAGG - Intronic
1028042271 7:86068387-86068409 CAGATAATGAGAGACAGAGAGGG - Intergenic
1028845860 7:95479190-95479212 CAGCTTATGACCACCAGAGCTGG + Intronic
1030824134 7:114133988-114134010 CAGACTAAGACAGCCAGTAGAGG + Intronic
1031199916 7:118668920-118668942 CAGAGTCTGACAGCCTGAGAAGG - Intergenic
1034972605 7:155428484-155428506 CAGACCAGGACAACCAGAGGAGG + Intergenic
1039394069 8:37208016-37208038 CAGAATATAACAGCCCGTGGAGG + Intergenic
1040006041 8:42621666-42621688 CAGATGATAACAGCCTGAGGTGG - Intergenic
1042959007 8:74282668-74282690 GAGATGAGGATAGCCAGAGGAGG + Intronic
1045340760 8:101252462-101252484 CAGATTGTGAGAGCCAGCAGAGG + Intergenic
1046566894 8:115913257-115913279 CAGACTTTGAGAGGCAGAGGCGG + Intergenic
1047660254 8:127025754-127025776 CAGATTCTGATAGCTAGAAGTGG + Intergenic
1052391815 9:27887962-27887984 TAGAATATCACAGGCAGAGGAGG - Intergenic
1055183076 9:73413649-73413671 CAGATTTTGAGATCCACAGGAGG - Intergenic
1056441792 9:86629265-86629287 CAGATTCTGTTTGCCAGAGGTGG + Intergenic
1057139518 9:92718138-92718160 CTGATTCTGACTGGCAGAGGAGG + Intronic
1058608782 9:106752750-106752772 CAGAGTGTGACAGCTGGAGGGGG - Intergenic
1060405795 9:123372535-123372557 CAGACTCTGAGAGCCACAGGGGG + Intronic
1190752600 X:53375258-53375280 TAGATCAGGACAGGCAGAGGTGG - Exonic
1192004829 X:67199329-67199351 CAGCTTCTGAGAGCCAGAGGAGG + Intergenic
1194426517 X:93745597-93745619 CAGCTTGTGGCAGGCAGAGGAGG + Intergenic
1195600061 X:106736394-106736416 CATGTTATGAAAGACAGAGGAGG - Intronic
1195654550 X:107322723-107322745 CAGCTTATGAGAGCCAGACTTGG - Intergenic
1195672060 X:107478005-107478027 AGGATTCTGATAGCCAGAGGAGG - Intergenic
1198154695 X:133947249-133947271 GTGATGATGACAGCAAGAGGAGG + Intronic
1198183592 X:134233493-134233515 AAGATGATGAGGGCCAGAGGAGG + Intergenic