ID: 1161351026

View in Genome Browser
Species Human (GRCh38)
Location 19:3791769-3791791
Sequence CTCAGTGATCTCTAGGAATT TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 204
Summary {0: 1, 1: 0, 2: 2, 3: 16, 4: 185}

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1161351026_1161351031 23 Left 1161351026 19:3791769-3791791 CCAAATTCCTAGAGATCACTGAG 0: 1
1: 0
2: 2
3: 16
4: 185
Right 1161351031 19:3791815-3791837 AGAACAGCTGAGGCCAGGCACGG 0: 2
1: 0
2: 28
3: 262
4: 1662
1161351026_1161351032 26 Left 1161351026 19:3791769-3791791 CCAAATTCCTAGAGATCACTGAG 0: 1
1: 0
2: 2
3: 16
4: 185
Right 1161351032 19:3791818-3791840 ACAGCTGAGGCCAGGCACGGTGG 0: 1
1: 16
2: 194
3: 1305
4: 6356
1161351026_1161351029 13 Left 1161351026 19:3791769-3791791 CCAAATTCCTAGAGATCACTGAG 0: 1
1: 0
2: 2
3: 16
4: 185
Right 1161351029 19:3791805-3791827 TTTGAGAAGTAGAACAGCTGAGG 0: 1
1: 0
2: 2
3: 21
4: 237
1161351026_1161351030 18 Left 1161351026 19:3791769-3791791 CCAAATTCCTAGAGATCACTGAG 0: 1
1: 0
2: 2
3: 16
4: 185
Right 1161351030 19:3791810-3791832 GAAGTAGAACAGCTGAGGCCAGG 0: 1
1: 0
2: 2
3: 35
4: 574

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1161351026 Original CRISPR CTCAGTGATCTCTAGGAATT TGG (reversed) Intronic
900658306 1:3771016-3771038 CTCAAAGATCTCTAGGAGTCTGG + Intronic
901422487 1:9160492-9160514 CTCAGTAATGTCAAGGACTTTGG - Intergenic
902033955 1:13442996-13443018 CATAGTGATTTCTAGCAATTAGG + Intergenic
904326182 1:29728144-29728166 CTCAGTGACATGTAGGAATGGGG + Intergenic
904433325 1:30479114-30479136 CTCAGTGACATGTAGGAATGGGG - Intergenic
907312817 1:53548952-53548974 ATCAGTGGTTTCTAGGGATTTGG - Intronic
909059521 1:70864358-70864380 AGCAGTTATCTCTAGCAATTAGG + Intronic
910790317 1:91043687-91043709 CACAGAGACCTCTAGGATTTTGG + Intergenic
911345532 1:96692467-96692489 CTCAGTGATCTCAAGACTTTGGG - Intergenic
913610495 1:120505502-120505524 CTCAGTGCTCTGTAGGGATATGG - Intergenic
914073283 1:144315204-144315226 CTAAGAGATCTTTAGGAATGAGG + Intergenic
914105871 1:144651156-144651178 CTAAGAGATCTTTAGGAATGAGG - Intergenic
914580695 1:149016737-149016759 CTCAGTGCTCTGTAGGGATATGG + Intronic
917212528 1:172644869-172644891 CTCAGACATCTCTCGGAACTGGG + Intergenic
918913329 1:190602507-190602529 CTCATTTATTTCTAGGAAGTAGG - Intergenic
920673497 1:208022975-208022997 CTCAGTGATCCCCATGAATGAGG - Exonic
920997873 1:211012598-211012620 ATCAGTGGTTGCTAGGAATTGGG + Intronic
921029288 1:211323513-211323535 CTCACTGATCTCTAGGTGATGGG + Intergenic
921057186 1:211551897-211551919 TCCAGCGATGTCTAGGAATTTGG + Intergenic
923671036 1:236041699-236041721 CTCAGTGATCTTTTGGGATTAGG - Intronic
924934412 1:248755937-248755959 CTCTGAGACCTCTAGGAATTGGG + Intergenic
1063037452 10:2300838-2300860 ATCAGTCATCAATAGGAATTTGG + Intergenic
1063218779 10:3947240-3947262 CTCTGTAATCTTTAGGAATTAGG + Intergenic
1063863850 10:10342561-10342583 CTCATTGACCTGTGGGAATTGGG - Intergenic
1064207491 10:13336304-13336326 CTCAGTGACCTCTATGCAATGGG - Exonic
1065546214 10:26823824-26823846 CTGAGTTATCTATAGGAGTTTGG - Intronic
1065801739 10:29358641-29358663 CTCAGAGATCTCTGGGAGGTGGG + Intergenic
1066125769 10:32340885-32340907 CTCATTGATTTCTCAGAATTTGG + Intronic
1067907843 10:50312396-50312418 TTCAGTGATCTCTTTGGATTTGG - Intronic
1069182477 10:65379191-65379213 ATCAGTGGTTTCCAGGAATTGGG + Intergenic
1071350711 10:84740705-84740727 TTCAGTTATATTTAGGAATTGGG + Intergenic
1073441953 10:103557430-103557452 CTCTAAGAACTCTAGGAATTGGG + Intronic
1077819686 11:5724857-5724879 CTCTGTGTTCCCTAGGAAATTGG - Intronic
1078117084 11:8464400-8464422 CTCAGTGTTCTGTAGGCATAGGG - Intronic
1078133304 11:8631514-8631536 CTTAGTGATATCAAGGAATTTGG + Intronic
1078914028 11:15760918-15760940 CTCGGGGATCACTAGGAATCAGG + Intergenic
1080604227 11:33851275-33851297 GTAGATGATCTCTAGGAATTTGG - Intergenic
1088600611 11:111471393-111471415 CTCTGTGATTTGTGGGAATTGGG - Intronic
1088729404 11:112667568-112667590 CTCAGTAATCTCTTGGATCTGGG + Intergenic
1092847922 12:12601362-12601384 CACAGTGATCTACAGGAACTTGG - Intergenic
1093062405 12:14620853-14620875 CTTAGAGTTCTCTAGGAACTGGG + Intronic
1093381893 12:18503092-18503114 CTCATTGTTCTCCAGGATTTTGG + Intronic
1093679761 12:21988344-21988366 CTCCGTGAACTCTGGGAACTGGG + Intergenic
1093876525 12:24355151-24355173 TGCAGTGATCTCTATGAATCTGG - Intergenic
1095975437 12:47938048-47938070 CTCAGAGATCTCTGGGGATGGGG - Intronic
1096123885 12:49105874-49105896 ATCAGTGGTCTTTAGGAACTGGG - Intronic
1097087633 12:56480238-56480260 TTCAGAGATCTTAAGGAATTAGG + Intronic
1097643396 12:62207967-62207989 CTCAGTGTTCACAAGGAATGAGG - Intronic
1099074484 12:78088991-78089013 CTCATTGATCTCTTAGCATTTGG + Intronic
1099338294 12:81393796-81393818 CTCAGTCATCTTGATGAATTTGG + Intronic
1104236251 12:126940303-126940325 TTCAGTGGTTTCCAGGAATTGGG + Intergenic
1104354487 12:128073363-128073385 CTCTGTGATCTCTTGGATCTGGG - Intergenic
1104534228 12:129603314-129603336 GTCAGTGGTTTCCAGGAATTGGG - Intronic
1106489221 13:30201934-30201956 CTCAGTGGTTGCCAGGAATTGGG + Intergenic
1106923820 13:34592096-34592118 CTATGTGAACTCTAGTAATTTGG - Intergenic
1106948871 13:34860299-34860321 CTCAGTGACATCGAGGAACTGGG - Intergenic
1107535135 13:41322008-41322030 ATCAGTTATCTTTAGGAATGAGG + Intronic
1107953970 13:45491511-45491533 CACAGTGATCTCTATTATTTTGG - Exonic
1109111924 13:58331765-58331787 CTCATTAAGCTTTAGGAATTGGG + Intergenic
1112809854 13:103205308-103205330 CTCATTGATCTCATGGACTTAGG + Intergenic
1115947613 14:38679913-38679935 CTCATTGATCACTGGCAATTAGG + Intergenic
1116971209 14:51067944-51067966 GTCAGTAATTTTTAGGAATTTGG - Intronic
1121593669 14:95140964-95140986 CTCCCAGATCTCTGGGAATTAGG - Intronic
1126189481 15:45864789-45864811 CTCTGTGGTCTTTAGGAATTTGG + Intergenic
1129368371 15:75070945-75070967 CTCAGAGATCTGAAGGAATAGGG + Intronic
1131635619 15:94230754-94230776 GTCTGTGCGCTCTAGGAATTTGG - Intergenic
1133660886 16:7916384-7916406 CCCAGTGATCACAAGAAATTGGG - Intergenic
1134210218 16:12270119-12270141 ATCTGTAATCTCTAGGACTTTGG - Intronic
1135481981 16:22828214-22828236 CTCAAAGATCTCTAGAAATGAGG - Intronic
1137847672 16:51707978-51708000 CCCAGTGAACTCTCGGAGTTGGG - Intergenic
1141232820 16:82186257-82186279 CTCAGTGAGCACAAGGAATGAGG + Intergenic
1142416566 16:89946635-89946657 CTCAGTGATCTCTGGGAGGCAGG - Intergenic
1146074729 17:29717679-29717701 AACAGAGATCTGTAGGAATTAGG + Intronic
1146450824 17:32972622-32972644 ACCAGTGATGTTTAGGAATTGGG - Intronic
1147127669 17:38383338-38383360 CTCAGTGCTCTCTAAGATGTAGG + Intronic
1151055678 17:71028244-71028266 CTCTGTCATCTATAGGTATTTGG - Intergenic
1158777315 18:60599838-60599860 TTCAGTATTCTGTAGGAATTGGG + Intergenic
1161351026 19:3791769-3791791 CTCAGTGATCTCTAGGAATTTGG - Intronic
1161998424 19:7728858-7728880 CTCAGTGACCTCTTGGCCTTTGG - Intergenic
1164473973 19:28559115-28559137 ATCAGTGATATCCAGGAGTTAGG - Intergenic
1164690777 19:30209361-30209383 CTCAAAAATCTCTAGGAAATCGG - Intergenic
1166177257 19:41083012-41083034 CCCAGTGATTTCAGGGAATTGGG + Intergenic
1166399961 19:42471265-42471287 CCCATATATCTCTAGGAATTAGG + Intergenic
1166730202 19:45054955-45054977 CTCAGTGATCACTAGAATTTTGG - Intronic
924971814 2:135342-135364 ATCAGTGGTTTCTAGAAATTGGG + Intergenic
927219949 2:20697458-20697480 ATCAGTTAGCCCTAGGAATTTGG - Intronic
927268739 2:21182911-21182933 CTCAGTGGCCTCCAAGAATTTGG + Intergenic
928391322 2:30913102-30913124 CTCTGTGATCTCTGGTACTTTGG - Intronic
928404017 2:31000511-31000533 CTGATTGATTTCTAGGAAATTGG + Intronic
929208478 2:39326206-39326228 CTCTGTGATCTCTGGGCAGTGGG - Exonic
931271304 2:60705758-60705780 CTCAGTCATCTATAGGGAGTGGG - Intergenic
931994003 2:67822680-67822702 CACAGGGAACTCCAGGAATTGGG - Intergenic
934183601 2:89650636-89650658 CTGAGAGATCTTTAGGAATGAGG + Intergenic
934819496 2:97359941-97359963 CCCAATCATCTCTAGAAATTGGG + Intergenic
936812248 2:116415923-116415945 TTCAATGATCTCTAAGAACTTGG - Intergenic
939145121 2:138404390-138404412 ATCAGTGGTCTCCAGGAGTTAGG + Intergenic
941214677 2:162691201-162691223 CTCTGTCTTCTCTATGAATTTGG - Intronic
941680098 2:168388699-168388721 CTCATTGATTGATAGGAATTTGG - Intergenic
944546530 2:200804374-200804396 CACAGTGATCTCAGGCAATTAGG + Intergenic
945263627 2:207868412-207868434 CTCAGTTGTCTCTGGGTATTGGG + Intronic
946482000 2:220066217-220066239 CAGAGTGGTCTCTAGGCATTTGG - Intergenic
946721365 2:222611899-222611921 CTCAGCGAGCCCTAGCAATTAGG + Intronic
1169516921 20:6326922-6326944 CTCACTGATATGTAGGAGTTAGG - Intergenic
1170060009 20:12248999-12249021 ATCAGGGATTTCTAGGAATTTGG + Intergenic
1172664252 20:36588192-36588214 CTCAGTTCTCTCTAGTACTTTGG + Intronic
1173891434 20:46513995-46514017 CTCGGATATCTCTGGGAATTGGG - Intergenic
1178190611 21:30275483-30275505 CTCAGTAATCTCTAATAAGTAGG - Intergenic
1178758301 21:35375083-35375105 CTATGGGATCTCTAAGAATTAGG + Intronic
1184583684 22:45433808-45433830 CCCAGTGATTTCTAGGCTTTGGG - Intergenic
949925321 3:9036692-9036714 CTGCGTGAGTTCTAGGAATTAGG + Intronic
951149709 3:19274669-19274691 CTCAGAAATCTCTAATAATTAGG - Intronic
951367183 3:21797821-21797843 ATCAGTGGTTTCCAGGAATTTGG + Intronic
954563711 3:51580453-51580475 CTCACTGAACTCTAAGAAGTAGG - Intronic
954960204 3:54557917-54557939 CTCAGTGATCTGAAGGAATAAGG + Intronic
960390749 3:117075040-117075062 CTCAGTGATTTCTGGGAAGCAGG + Intronic
962632377 3:137291611-137291633 CAAACTCATCTCTAGGAATTTGG - Intergenic
964460620 3:156922240-156922262 GTCACTGAACTCTAGAAATTTGG - Intronic
964951288 3:162297104-162297126 CTCAGTGGCCTCCAAGAATTTGG - Intergenic
966382510 3:179357618-179357640 CCCAGTGATATCTGGGACTTGGG + Intronic
970043652 4:11824819-11824841 CTCAGTGATCTAGAGAAATTAGG - Intergenic
970356224 4:15255753-15255775 ATCACTGCTCTCAAGGAATTTGG - Intergenic
972046463 4:34671126-34671148 CTTAATGATCTCTATGATTTTGG + Intergenic
976505552 4:85842266-85842288 CTCAATCATTTCTATGAATTTGG + Intronic
977079365 4:92504311-92504333 CACAGAGGCCTCTAGGAATTTGG - Intronic
979361156 4:119766295-119766317 CCCAGTGATATCTAAGAAGTAGG - Intergenic
980331765 4:131419720-131419742 TTCAGTGATCTCTTAGAAGTAGG - Intergenic
981382630 4:144090745-144090767 CTCAGTGACCTCTTGGTATCCGG - Intergenic
981543870 4:145874057-145874079 CTTAATGATCTCTAGAAGTTGGG - Intronic
983038174 4:162892976-162892998 CTCAGTGATCCCAAGAAACTTGG - Intergenic
984026689 4:174551287-174551309 ATCAGTGATTGCTAGGATTTGGG - Intergenic
987023619 5:13900472-13900494 CTCAGCTATCTCTAGGAATAAGG + Intronic
987142567 5:14960579-14960601 CTGAGTGACCTCTAGGACATAGG + Intergenic
988875491 5:35441131-35441153 ATCAGTGGTCACTAGGATTTGGG + Intergenic
990018006 5:51090221-51090243 ATCAGTGGTTTCTAAGAATTAGG + Intergenic
990171117 5:53050719-53050741 CTTATTGATCTCTAGGATTAGGG + Intronic
990667194 5:58086335-58086357 CTCAGTAATCTGAAGGGATTTGG + Intergenic
994815540 5:104582209-104582231 ATCAGTGGTTGCTAGGAATTTGG - Intergenic
995056992 5:107770552-107770574 CTCAGTTATTTCTATGAATATGG + Intergenic
997871754 5:137512028-137512050 ATCAGTGATGTCCAGGAAATAGG + Intronic
997908056 5:137840185-137840207 TGCAGGGATCTCTTGGAATTTGG + Intergenic
998863117 5:146465255-146465277 CTGAGTGATCTCAAGGAGTTGGG + Intronic
1000827301 5:166060917-166060939 TTCAGTGTTCTTTAGAAATTTGG - Intergenic
1005079552 6:21943495-21943517 CTCAGGGATTTCAAGGACTTGGG + Intergenic
1005814330 6:29538660-29538682 CTCAGTGTTCTCTGGGAAGCTGG - Intergenic
1008508742 6:52256342-52256364 CTAAGTGATACCTAGGACTTGGG + Intergenic
1009980049 6:70717082-70717104 CTTAGTGGTCTCCAGTAATTAGG + Intronic
1010709516 6:79156723-79156745 CTAAGTGATTTTTATGAATTAGG - Intergenic
1011328613 6:86178561-86178583 CTCATTGATTTATAGGCATTTGG + Intergenic
1012533526 6:100267590-100267612 CACAGTGGTCGTTAGGAATTTGG - Intergenic
1013662393 6:112310591-112310613 CTAAGTGATCTGGGGGAATTGGG + Intergenic
1013753948 6:113439063-113439085 CTAAGTGATATCTGGGAAATGGG - Intergenic
1014651242 6:124040902-124040924 CTCATTGAACTCTATGAACTAGG - Intronic
1016912478 6:149212990-149213012 CTCAGTTTTCTCTGTGAATTAGG - Intergenic
1018793524 6:167168813-167168835 CTCAGTCATCTCTACAAGTTGGG - Intronic
1018823191 6:167389565-167389587 CTCAGTCATCTCTACAAGTTGGG + Intergenic
1020153456 7:5702020-5702042 CTCCCTGATCCCTAGGAAATGGG - Intronic
1020258801 7:6518790-6518812 CACTGTGATCTAAAGGAATTTGG + Intronic
1020614084 7:10437046-10437068 CTCAGTGATTCCTTGGAAATAGG + Intergenic
1021486549 7:21174419-21174441 TCCAGTGATCTTTAAGAATTGGG - Intergenic
1025807897 7:64853016-64853038 CTCAGTGACCTCTACGCAATGGG - Intergenic
1026590186 7:71687633-71687655 CATGGTGATTTCTAGGAATTGGG - Intronic
1030887589 7:114957555-114957577 ATCAGTGGTATCTAGGCATTTGG + Intronic
1031228544 7:119074420-119074442 CACAATTATCTCTAGGAATAGGG - Intergenic
1031603759 7:123745681-123745703 CTGAGTAATATCTAGGAATTGGG + Intronic
1031841740 7:126750292-126750314 ATCAGTGATTTCTAAGAAATGGG + Intronic
1032963908 7:137073317-137073339 CTCAGTGAAGTATAGGAAGTGGG - Intergenic
1034292984 7:149947090-149947112 CTCAGTGATGTGTAGGACATGGG - Intergenic
1034813088 7:154149783-154149805 CTCAGTGATGTGTAGGACATGGG + Intronic
1035076016 7:156178098-156178120 TTCAGTGATCTCTGAGATTTTGG - Intergenic
1035909341 8:3548719-3548741 CTCATTGATTGATAGGAATTTGG + Intronic
1036997668 8:13677799-13677821 CTCAGTGACCTTTTGGAAATGGG - Intergenic
1039176318 8:34810936-34810958 CTTAGTGTCCTCTAGTAATTTGG - Intergenic
1039332914 8:36558928-36558950 CACAGTTAACTCTAGAAATTTGG + Intergenic
1039743991 8:40407298-40407320 GTCAGAGATGCCTAGGAATTTGG - Intergenic
1040876935 8:52163443-52163465 CTTGGTGATATCTAGAAATTTGG - Intronic
1041380671 8:57251489-57251511 ATCAGTGATTGCTAGGGATTGGG - Intergenic
1043277450 8:78417368-78417390 CTCAGTGATCTCTAAGGATTCGG - Intergenic
1044760223 8:95510103-95510125 CTCAGTGAACTCTACAAATGTGG - Intergenic
1045363436 8:101453894-101453916 CTCTGTGATCACTAGGAATAGGG + Intergenic
1046137184 8:110043227-110043249 CTGAGTGAGCTCTAGAAATTAGG - Intergenic
1047349097 8:124056226-124056248 CTGAGATATTTCTAGGAATTGGG - Intronic
1047708644 8:127527300-127527322 ATCAGTGGTTTCCAGGAATTAGG - Intergenic
1047801989 8:128319404-128319426 CTCACTTGTCTCTAGGAAGTAGG + Intergenic
1050124225 9:2339718-2339740 TTCAGTCATGTCTAGAAATTTGG - Intergenic
1050319572 9:4437485-4437507 CTCAATTACCTCTAAGAATTAGG + Intergenic
1051129005 9:13838100-13838122 CTCATTGATCTGTAGGTCTTAGG - Intergenic
1053041512 9:34877668-34877690 CTCAGTGATTACCAGGGATTTGG + Intergenic
1055575058 9:77652553-77652575 CTCACTGAACTCTGGGTATTTGG - Intergenic
1056419091 9:86406279-86406301 CTTCGTGCTCTCTAGGCATTGGG - Intergenic
1060415518 9:123427024-123427046 CACAGTGATCTCTAGCAAGCTGG + Intronic
1186592889 X:10950217-10950239 CTCAGTGATCTCTCTAAATGTGG - Intergenic
1187545013 X:20242033-20242055 CTCAGTTATTTCTAGATATTAGG - Intronic
1187783263 X:22854033-22854055 ATCAGTGATTTCTAGGAGTTAGG + Intergenic
1187861243 X:23685202-23685224 CTCACTGATCTCTGGGAACTTGG + Intronic
1188021911 X:25168494-25168516 CTCATTGGTCTCTAGGTTTTTGG + Intergenic
1188074964 X:25764036-25764058 TTCAGTGATCTTTAGTAATATGG - Intergenic
1189232198 X:39461216-39461238 CTCAGTGATCCCTGGGATGTAGG - Intergenic
1192727727 X:73769569-73769591 CTCAGTGACCTCTATGCAATGGG + Intergenic
1192738929 X:73874875-73874897 AACAGTGACCTCTAGGATTTGGG - Intergenic
1195767528 X:108312223-108312245 CACAGTGCTCTCTAGGAATTAGG - Intronic
1196057027 X:111366984-111367006 CTCAGTCTTCTCTTTGAATTGGG - Intronic
1196529543 X:116769101-116769123 ATTAGTGGTCTCTAGGAGTTAGG + Intergenic
1201282523 Y:12353931-12353953 CTCAGGGATCTCCAGGACCTGGG - Intergenic
1201618877 Y:15932837-15932859 CTCAGGCATCTCTAAGAATACGG + Intergenic