ID: 1161354077

View in Genome Browser
Species Human (GRCh38)
Location 19:3809488-3809510
Sequence GGCCTCCCACAGCACTGTGT GGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 317
Summary {0: 1, 1: 0, 2: 5, 3: 28, 4: 283}

Found 8 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1161354064_1161354077 22 Left 1161354064 19:3809443-3809465 CCCTGTGGCCAGTTCCCGAGGGC 0: 1
1: 0
2: 1
3: 11
4: 119
Right 1161354077 19:3809488-3809510 GGCCTCCCACAGCACTGTGTGGG 0: 1
1: 0
2: 5
3: 28
4: 283
1161354073_1161354077 7 Left 1161354073 19:3809458-3809480 CCGAGGGCACGAGGGGACAGGGG 0: 1
1: 0
2: 2
3: 37
4: 305
Right 1161354077 19:3809488-3809510 GGCCTCCCACAGCACTGTGTGGG 0: 1
1: 0
2: 5
3: 28
4: 283
1161354062_1161354077 23 Left 1161354062 19:3809442-3809464 CCCCTGTGGCCAGTTCCCGAGGG 0: 1
1: 0
2: 0
3: 15
4: 127
Right 1161354077 19:3809488-3809510 GGCCTCCCACAGCACTGTGTGGG 0: 1
1: 0
2: 5
3: 28
4: 283
1161354060_1161354077 24 Left 1161354060 19:3809441-3809463 CCCCCTGTGGCCAGTTCCCGAGG 0: 1
1: 0
2: 1
3: 8
4: 138
Right 1161354077 19:3809488-3809510 GGCCTCCCACAGCACTGTGTGGG 0: 1
1: 0
2: 5
3: 28
4: 283
1161354071_1161354077 8 Left 1161354071 19:3809457-3809479 CCCGAGGGCACGAGGGGACAGGG 0: 1
1: 0
2: 0
3: 43
4: 286
Right 1161354077 19:3809488-3809510 GGCCTCCCACAGCACTGTGTGGG 0: 1
1: 0
2: 5
3: 28
4: 283
1161354065_1161354077 21 Left 1161354065 19:3809444-3809466 CCTGTGGCCAGTTCCCGAGGGCA No data
Right 1161354077 19:3809488-3809510 GGCCTCCCACAGCACTGTGTGGG 0: 1
1: 0
2: 5
3: 28
4: 283
1161354068_1161354077 14 Left 1161354068 19:3809451-3809473 CCAGTTCCCGAGGGCACGAGGGG 0: 1
1: 0
2: 10
3: 7
4: 94
Right 1161354077 19:3809488-3809510 GGCCTCCCACAGCACTGTGTGGG 0: 1
1: 0
2: 5
3: 28
4: 283
1161354059_1161354077 25 Left 1161354059 19:3809440-3809462 CCCCCCTGTGGCCAGTTCCCGAG 0: 1
1: 0
2: 0
3: 12
4: 195
Right 1161354077 19:3809488-3809510 GGCCTCCCACAGCACTGTGTGGG 0: 1
1: 0
2: 5
3: 28
4: 283

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1161354077 Original CRISPR GGCCTCCCACAGCACTGTGT GGG Intronic
900406698 1:2495970-2495992 GGCCTTCCTCAGCACTGTCTGGG + Intronic
901574413 1:10189393-10189415 GGCCTCCCAAAGCAAAGTGCTGG - Intergenic
901814538 1:11786693-11786715 GGCCTCCCAAAGCATTGGGCAGG + Exonic
902631517 1:17707297-17707319 GTCCTCACACAGCAAAGTGTTGG - Intergenic
902675387 1:18005162-18005184 ATCCTCCCACAGCATTCTGTGGG - Intergenic
903014657 1:20354074-20354096 GGCCTCCTACTTCACTGAGTGGG + Exonic
904342131 1:29843455-29843477 AGCCTCCCACAGCCCCGTGGGGG + Intergenic
906393695 1:45441869-45441891 GGCCTCCCAAAGTGCTGTGCTGG + Intronic
910995054 1:93095592-93095614 GGCCTCCCAAAGTACTGACTGGG + Intronic
913230184 1:116735096-116735118 GTCCTCCCACAGCACTCGCTTGG - Intergenic
913563627 1:120048311-120048333 GGTCTCCAACAGCACTTTGGGGG - Intronic
913634497 1:120745266-120745288 GGTCTCCAACAGCACTTTGGGGG + Intergenic
914284222 1:146207677-146207699 GGTCTCCAACAGCACTTTGGGGG - Intronic
914481389 1:148069247-148069269 GGCCTCCCAAAGTACTGGGATGG - Intergenic
914545253 1:148658416-148658438 GGTCTCCAACAGCACTTTGGGGG - Intronic
914621315 1:149412263-149412285 GGTCTCCAACAGCACTTTGGGGG + Intergenic
914801489 1:150965853-150965875 GCCCTCCCTCAGCTCTCTGTGGG - Exonic
914955047 1:152154517-152154539 GGCCTCCCACTGCTCTGGGTTGG + Exonic
915307604 1:154989625-154989647 AGCCTCACCCAGCTCTGTGTGGG + Exonic
916960220 1:169882031-169882053 GGGCTCCCACAGTGCTGTGGTGG - Intronic
918238121 1:182599560-182599582 GGCCACCCAGAGCACTGAGCTGG + Exonic
918696433 1:187551341-187551363 AGCCTGCCGCAGCACTGTGGAGG - Intergenic
920698189 1:208197842-208197864 TGCTGCCCACAGCACTGGGTAGG + Intronic
921339516 1:214120764-214120786 GGCCTCCCACTGCACACTGGTGG + Intergenic
921385030 1:214560161-214560183 GGCCTCCCAAAGTGCTGGGTGGG + Intergenic
922565144 1:226596817-226596839 GGCCCCGCACAGCACAGTGAAGG - Exonic
923232192 1:231997515-231997537 GGCCTTCCTCAGCAATGTGAAGG - Intronic
923276298 1:232399963-232399985 TGCCACCCCCAGCACTGTGCAGG + Intronic
1062822596 10:546025-546047 GGCCTCCCAAAGTGCTGGGTGGG - Intronic
1064263290 10:13803590-13803612 AGCCTCCCAAAGCACTGGGATGG + Intronic
1064989844 10:21246589-21246611 GGCCTCCCAAAGCACTAGGCAGG - Intergenic
1066067700 10:31774330-31774352 GGCCACCCAAAGCACTTGGTGGG + Intergenic
1066101639 10:32123007-32123029 GGCCTCCCACTCCACAGAGTAGG - Intergenic
1066105347 10:32151475-32151497 GGCCTCCCAAAGTGCTGTGAAGG + Intergenic
1066613655 10:37275765-37275787 GGCCTCCCACAGTGCAGTGGTGG + Intronic
1067153227 10:43753423-43753445 GCCCTCACACAGGACTGTTTAGG - Intergenic
1067556996 10:47279462-47279484 GGACTCCCACAGCACCCCGTGGG - Intergenic
1067739389 10:48883011-48883033 TGCCTCCCAGCTCACTGTGTTGG + Intronic
1067788971 10:49273224-49273246 CCCCTCCCACAGCTCTGTGCTGG + Intergenic
1068821029 10:61377315-61377337 GGCCTGCCACTGCGCTGTGGAGG - Intergenic
1069032492 10:63612424-63612446 GGCCTCCCAGAGTGCTGTGTGGG + Intronic
1070188920 10:74093532-74093554 GGCCTCCCAGAGTCCTGTGCTGG - Intronic
1070601501 10:77869380-77869402 GGCCTCCCACCTCACTTTATCGG + Intronic
1071487824 10:86114411-86114433 GTGCTCCCACAGCCCTGTGAAGG + Intronic
1072332574 10:94368175-94368197 GGATTGCCACAGCACTCTGTAGG - Intergenic
1073575674 10:104620833-104620855 GGCCTCCAACAGGCCTGGGTTGG + Intergenic
1074881623 10:117663963-117663985 GTCATCACACAGCACTCTGTTGG + Intergenic
1074929928 10:118114204-118114226 GGCATCACACAGAACTGAGTAGG + Intergenic
1075291794 10:121237084-121237106 GTCCTCCCACTGCTCTGTGGTGG - Intergenic
1075498135 10:122945840-122945862 GGCCTCCCAAAGTACTGGGTGGG - Intronic
1076648148 10:131968852-131968874 GACTTCCCCCAGCACTGAGTTGG - Intronic
1076677220 10:132153397-132153419 GGCCTCCCACAGCAAGGAGAAGG + Intronic
1076811596 10:132889114-132889136 GCCCTCCCCCAGCACTCTGCAGG + Intronic
1077120028 11:902928-902950 GACCTCCCTCTGCACTGTGAGGG + Intronic
1077458750 11:2698310-2698332 GCCTTCCCACAGCACTGTTCTGG - Intronic
1077487513 11:2845864-2845886 AGCCTCTCACAGCACCCTGTTGG + Intronic
1078714948 11:13831009-13831031 GACTTCCCACAACACTTTGTGGG + Intergenic
1079215356 11:18505505-18505527 GGCCTCCCAAAGTGCTGGGTGGG + Intronic
1081472060 11:43383617-43383639 GGCCTCCCACAGTGCTGGCTGGG + Intronic
1082988539 11:59187752-59187774 GCCCTCCCACAGCGCTGACTTGG - Intronic
1083019222 11:59489253-59489275 GTGCTCCCACAGCACTATATTGG + Intergenic
1083647139 11:64178669-64178691 CGTCTCACACAGCACTGTCTGGG - Intergenic
1084091043 11:66879570-66879592 GGCCTCCAGCAGCCTTGTGTTGG - Intronic
1084240753 11:67818057-67818079 GGGCTCCCACAGTACAGTGGTGG + Intergenic
1084495326 11:69500107-69500129 CGCCTCCGGCAGCACTGTGATGG + Intergenic
1088328862 11:108629318-108629340 AGCCTCCCTCAGCACTGCCTAGG + Intergenic
1089744702 11:120608633-120608655 TGCCTTTCAAAGCACTGTGTAGG + Intronic
1091816408 12:3442382-3442404 TGCCTCCCAGAACTCTGTGTAGG + Intronic
1092268228 12:7000331-7000353 GGCCTCCCAAAGAGCTGGGTGGG - Intronic
1092502232 12:9059932-9059954 GGCCTCCCAAACCAAAGTGTTGG + Intergenic
1093679291 12:21982161-21982183 GGAATCCCACAGCAATGTGTTGG - Intergenic
1093910400 12:24740848-24740870 GTGGTTCCACAGCACTGTGTCGG - Intergenic
1094016198 12:25866977-25866999 GGTCTCCACCAACACTGTGTGGG - Intergenic
1094084229 12:26572225-26572247 GGCCTCCCATAAAACTTTGTTGG - Intronic
1094363231 12:29652370-29652392 AGCCTATCACTGCACTGTGTGGG + Intronic
1095801846 12:46277057-46277079 GGCCTCCAACAGCTCACTGTGGG + Intergenic
1095887843 12:47207397-47207419 GGCCTCACACAGCTCTGGGGAGG - Intronic
1096071056 12:48775772-48775794 GGACACCCTCAGCACAGTGTTGG - Intronic
1096576715 12:52557478-52557500 GGCCCCCCTCAGCACTTGGTAGG - Intergenic
1097441597 12:59614732-59614754 GGCCTCCCAAAGTGCTGGGTGGG - Intronic
1099559397 12:84153763-84153785 GGCCTCCCAAAGTGCTGGGTAGG - Intergenic
1099884416 12:88509435-88509457 GGCCTCCCACACAGCTTTGTTGG - Intronic
1100322024 12:93504392-93504414 GGCCTCCCAAAGTGCTGGGTGGG + Exonic
1102584689 12:113914776-113914798 GGCTCCCCAGAGCACTGTGCAGG - Intronic
1102629919 12:114269149-114269171 TTGCTCACACAGCACTGTGTCGG - Intergenic
1103326469 12:120124658-120124680 GTCCTCCCGCATCACAGTGTTGG + Intergenic
1103894316 12:124263195-124263217 GGCCTCCCAAAGCGCTGGGTGGG + Intronic
1104632835 12:130418888-130418910 GGCCTCAGGCAGCTCTGTGTTGG - Intronic
1104951069 12:132440399-132440421 GTCCTGCTACATCACTGTGTTGG - Intergenic
1104977717 12:132559785-132559807 GGCCTCACTGAGCGCTGTGTGGG - Intronic
1106728640 13:32514881-32514903 GGCCTCCCAAAGTGCTGGGTGGG - Intronic
1108209549 13:48124504-48124526 GGCCTCCTACAGCACTCACTTGG + Intergenic
1108437607 13:50416360-50416382 AGCATCCCAGAGCAGTGTGTTGG + Intronic
1108884720 13:55165629-55165651 TGCCAGCCAAAGCACTGTGTTGG - Intergenic
1110193854 13:72763041-72763063 GGCCTCCCAAAGTGCTGTGCTGG - Intronic
1111190721 13:84803323-84803345 GGCCTGCCACACCACTGGGCAGG + Intergenic
1112077821 13:95931880-95931902 AGCCTGCCACTGCACTGTGGGGG - Intronic
1113024709 13:105928191-105928213 GTCCTTCCACAGCAGAGTGTGGG + Intergenic
1113559894 13:111270278-111270300 GTCAGCCCACAGCACTGTGTCGG + Intronic
1114235263 14:20817838-20817860 GGCCTCCCAAAGTGCTGGGTGGG + Intergenic
1115285933 14:31712574-31712596 GGGCCCCCACAGCACAGTGGCGG + Intronic
1116154685 14:41188033-41188055 GGCCTCAACCAGCACAGTGTAGG - Intergenic
1116265211 14:42679577-42679599 AGCCTTCCACAGTGCTGTGTAGG + Intergenic
1116623949 14:47242363-47242385 GGGCTCCCACAGTACAGTGGGGG - Intronic
1118350462 14:64969997-64970019 TGCCTCCCACAGCACTAAGCAGG + Intronic
1119147269 14:72328691-72328713 GGCCTTCCAGAGGACTCTGTTGG - Intronic
1119266295 14:73264833-73264855 GGCCTCCCAGAGCCCTGAGCAGG - Intronic
1119284645 14:73443114-73443136 GGCCTCCCAAAGCACTGTGCTGG + Intronic
1119604523 14:76003371-76003393 GGCCTCCCAAAGTGCTGTGCTGG - Intronic
1121105663 14:91277972-91277994 GGCCTCCCCCAGCAGTGAGATGG - Exonic
1122882716 14:104697224-104697246 GGCCTTCCACAGCACAGTGTGGG - Intronic
1125512510 15:40300058-40300080 GGCCTCCCAAAGTGCTGTGTGGG - Intronic
1125644030 15:41255759-41255781 GGCCTCCCAAAGTGCTGGGTGGG - Intronic
1126575885 15:50195799-50195821 GGCCTCCCAAAGTGCTGGGTAGG - Intronic
1127774468 15:62254412-62254434 TGCCTCCCACGGCACTGGGAAGG + Intergenic
1128321529 15:66698141-66698163 GGCCACCCACAGCAGCGTGGAGG - Intergenic
1128468864 15:67935282-67935304 GGCCTCCCACAGAACAGAGTTGG - Intergenic
1128776720 15:70326077-70326099 GGCAGCCCACAGCGCTGCGTGGG + Intergenic
1130028682 15:80292946-80292968 GGTCTCCCTCAGCAGTGTGTGGG + Intergenic
1130683705 15:86018802-86018824 GGGCTCTCCCAGCAGTGTGTGGG + Intergenic
1131012764 15:89032094-89032116 GGGCTCCCACAGCGCAGTGGCGG + Intergenic
1131188052 15:90292316-90292338 TGCCTCCCATAGCACTGGGAAGG - Intronic
1131311099 15:91290754-91290776 GGCCTCCCAAATCACTGAGTTGG - Intronic
1131851764 15:96550915-96550937 AGCATCCCACAGCAGTGGGTGGG + Intergenic
1134130929 16:11649651-11649673 GGCCTCCCAAAGCACTAGGATGG - Intergenic
1134475254 16:14568093-14568115 GGCCTCCCACAGTGCTGGGTAGG - Intronic
1134797699 16:17056899-17056921 GGCCTACCTCAGCACTATGTTGG - Intergenic
1135266247 16:21028404-21028426 GGCCTCCCAAAGTGCTGTGCTGG - Intronic
1137268780 16:46888902-46888924 GGCCTCCCAAAGTGCTGGGTGGG + Intronic
1138013988 16:53412743-53412765 GGGCCCCCACAGCACAGTGGCGG - Intergenic
1138316224 16:56072587-56072609 GGCTCCCCACAGCACTTTGCAGG + Intergenic
1138600175 16:58049377-58049399 GGCCTCTGCCAGCACTTTGTGGG - Intergenic
1139431040 16:66911192-66911214 GGCCTCCACAAGCACCGTGTAGG + Exonic
1139846830 16:69927362-69927384 TGAGTCCCACAGCAGTGTGTGGG - Intronic
1142264018 16:89055367-89055389 GGCCTCCCCCAACCCTGTGTGGG + Intergenic
1203124119 16_KI270728v1_random:1560744-1560766 GCCTTCCCTCGGCACTGTGTTGG + Intergenic
1142695419 17:1630107-1630129 GGGCTCCCACAGCCCTGGGGTGG - Intergenic
1143250999 17:5522930-5522952 CTCCTCCTCCAGCACTGTGTGGG + Intronic
1143708808 17:8719033-8719055 AGCCTCCCACACCACACTGTGGG + Intergenic
1144842057 17:18193110-18193132 GGCCTCCCAAAGTGCTGGGTGGG + Intronic
1145825601 17:27875054-27875076 GGCCTCCCAAAGTGCTGGGTGGG + Intronic
1146198954 17:30839078-30839100 GGACTCCCACAGTGCTGTGCTGG + Intronic
1147300104 17:39519533-39519555 AGCCTCCCAAAGTGCTGTGTGGG + Intronic
1148746971 17:49923994-49924016 GGCATCCCTCAGCACTGAGGAGG - Intergenic
1148748528 17:49931580-49931602 TGCCTCCCCCATCACTCTGTGGG - Intergenic
1150792184 17:68207777-68207799 GGGCTCCCACAGTACAGTGGCGG - Intergenic
1152201269 17:78947819-78947841 GGCCTCCCACAGCCCAGAGGAGG - Intergenic
1152368878 17:79872667-79872689 GGCCTCCCAAAGTGCTGAGTAGG + Intergenic
1153475677 18:5495988-5496010 GACCTCTCCCACCACTGTGTGGG + Intronic
1156279907 18:35627090-35627112 TGTCTCCCACAGTGCTGTGTAGG + Intronic
1157914491 18:51651601-51651623 TGCCTCCCATAGAACTGTGCAGG + Intergenic
1159232256 18:65624120-65624142 TGCTTCCCACACAACTGTGTTGG - Intergenic
1159790434 18:72772517-72772539 TGCCTCTCCCACCACTGTGTTGG - Intronic
1160534338 18:79584257-79584279 TGCCTCCCATGGCACCGTGTTGG + Intergenic
1161354077 19:3809488-3809510 GGCCTCCCACAGCACTGTGTGGG + Intronic
1161370255 19:3907482-3907504 GGCCTCCCAGGGCACTCTGTTGG - Intronic
1162583361 19:11544223-11544245 GGCCTCCCAGACCACTCTCTAGG - Intronic
1163035362 19:14566341-14566363 GCCGTCCCAGAGCACTGTGGGGG + Intronic
1163300665 19:16443808-16443830 GGCCTCCCAAAGTGCTGTTTGGG - Intronic
1163364483 19:16868468-16868490 AGCCTCCCACACCACTGTCCTGG - Intronic
1166798463 19:45442055-45442077 GGCCTCCCAAAGTGCTGGGTGGG - Intronic
1166846851 19:45733708-45733730 GGCCTCCCCCAGCACTAGCTGGG + Intronic
1167038373 19:47007773-47007795 AGCCTCCCAAAGCACTGGGAGGG + Intergenic
1167260111 19:48453590-48453612 GGCCTCCCAGAGTGCTGGGTTGG + Exonic
1167548276 19:50142097-50142119 GGCCTCCCAAAGGCCTGTGCTGG - Intergenic
1168539761 19:57200349-57200371 GGCCTCCCAAAGCGCTGGGATGG - Intronic
1168663289 19:58183758-58183780 GGACTCCCACAGGACTGGATAGG - Intronic
926680216 2:15657441-15657463 GGCCTCCCAAAGCGCTGGGCGGG - Intergenic
932429093 2:71663287-71663309 GCCCTCCCACTGCACTTTCTGGG + Intronic
932480861 2:72038285-72038307 GGCCTCCCAGTGCAATGTGCTGG + Intergenic
932822125 2:74910699-74910721 GGCCTCCCACTGCCCTGGGTGGG + Intergenic
933415764 2:81985095-81985117 GGCCTCCCACAGTGCAGTGGCGG - Intergenic
933474066 2:82766450-82766472 GGCCTGCCCCAGCACTGTGTTGG + Intergenic
933731958 2:85463189-85463211 GGCCTCCCAAAGTGCTGGGTGGG + Intergenic
934056876 2:88258540-88258562 GGCATCCCCCACCACTGTGTGGG - Intergenic
936013019 2:108937007-108937029 GGCCCCCCACAGTGCTGTGCCGG + Intronic
936606094 2:113955997-113956019 GGCCTCCCAAAGCAAAGTGTTGG + Intronic
938399322 2:130975840-130975862 GACCGCCCAGAGCACTGTGATGG - Intronic
940024817 2:149194767-149194789 AGCTTCCCAGAGCACAGTGTAGG + Intronic
940650871 2:156439326-156439348 GGCCTCCCAAAGCAAAGTGCTGG - Intronic
940739308 2:157488993-157489015 GCCCTCCCCCAGCTCTGTGCAGG - Intergenic
944159602 2:196644402-196644424 AGCCACCAACAGCACTGGGTGGG - Intronic
944248617 2:197558594-197558616 GGCCTCCCAGAGTGCTGTGCTGG + Intergenic
944871698 2:203918562-203918584 GGCATCCCACAGCACAGAGGAGG + Intergenic
945661456 2:212690804-212690826 GGCCTCCCAGAGCACAGAGCAGG - Intergenic
947539421 2:230964695-230964717 GGCCTCCCGCTGCACTGTGTGGG - Intergenic
948098066 2:235352291-235352313 GGCCTCCCAAAGTGCTATGTTGG - Intergenic
948476481 2:238223985-238224007 GGCCTCCCAAAGTGCTGGGTGGG - Intergenic
1169195697 20:3681078-3681100 TGGCTTCCACAGCACTGTGTGGG - Intronic
1171391073 20:24802111-24802133 GCCCTGCAGCAGCACTGTGTGGG - Intergenic
1171480542 20:25452565-25452587 ATCCTGCCACAGCACTGTGGAGG - Intronic
1172134676 20:32679029-32679051 GGCCTGTCAGGGCACTGTGTCGG + Intergenic
1173555314 20:43961597-43961619 GGCCTCCAGCTGCACTGTGGCGG + Intronic
1174042225 20:47708220-47708242 GGCCTCTCACAGCACTGCGTGGG - Intronic
1174449491 20:50610607-50610629 GGACTCCCTGAGGACTGTGTGGG - Intronic
1175656493 20:60775673-60775695 TGCCTCCCACAACACTCTGAGGG + Intergenic
1178264965 21:31134244-31134266 GTAGTCCCACATCACTGTGTGGG + Intronic
1182039245 22:27223646-27223668 GGCCTCCCCCAGCAATTTCTTGG - Intergenic
1183079961 22:35450036-35450058 AGCCTCCCACAGTACTGGGATGG + Intergenic
1183668865 22:39260458-39260480 GGCCTCCAACAGGGCCGTGTTGG + Intergenic
1184039161 22:41933199-41933221 CTCCTCCCTCAGCCCTGTGTGGG + Intergenic
1184152512 22:42647022-42647044 GGCCTCTCCCAACACTTTGTGGG - Intronic
1184537825 22:45099625-45099647 GGCCTCCCCCAGCACAGAGAAGG - Intergenic
1184799743 22:46752238-46752260 GGGCTCCCAGAACACTGTGCAGG + Intergenic
1184906001 22:47487073-47487095 GGCCTGCCACAGACCTGTGCAGG + Exonic
949104313 3:185049-185071 GGGCTTCCACAGCACTTTATGGG + Intergenic
950535549 3:13576153-13576175 GTCCTCCCACAGCACTTGCTGGG - Intronic
951505572 3:23441268-23441290 GGCCTCCCAAAGTACTGGCTGGG - Intronic
953099941 3:39814213-39814235 GCCCTCCTACTGCATTGTGTTGG + Intronic
953667762 3:44938236-44938258 GGCCTCCCAAAGTGCTGGGTGGG + Intronic
953793929 3:45968394-45968416 GGCCACCCAGAACACTGTGAAGG - Exonic
954259178 3:49426281-49426303 GGGCTCCCTCCTCACTGTGTGGG + Exonic
954294211 3:49665140-49665162 GGGCTCTCACAGCACTGGGCTGG + Intronic
954333390 3:49902638-49902660 GGCCACCCGCAGCACAGGGTAGG + Exonic
954461307 3:50628635-50628657 GGCCTCCCCCGGCCCTCTGTGGG + Intronic
955140125 3:56260520-56260542 CACCTCCCACAGCTCTGGGTGGG - Intronic
958713678 3:97751136-97751158 GGTCTTCCACAGGACTCTGTCGG + Intronic
959546906 3:107607145-107607167 GGAGTGCAACAGCACTGTGTCGG + Intronic
960978427 3:123199706-123199728 GGCCTCCCAAAATGCTGTGTTGG + Intronic
961462019 3:127056549-127056571 AGCCTGCCACTGCACTGTGGGGG - Intergenic
961828285 3:129610283-129610305 GGCCTTCCACCCCACTGGGTGGG + Intergenic
962485001 3:135833751-135833773 GTCCTCCCACAGGTCTGAGTAGG + Intergenic
966887063 3:184382663-184382685 GGCCCCCCACAGCAGGGCGTAGG + Exonic
967990414 3:195126192-195126214 TGCCTCACGCAGCACTGAGTGGG - Intronic
968599779 4:1503527-1503549 GGCCCCCCACGCCACTGTGGCGG - Intergenic
971524372 4:27598005-27598027 GCACTCCCACTGAACTGTGTGGG - Intergenic
972128481 4:35800886-35800908 GGCCTCCCACACCACAGAGCAGG + Intergenic
973146250 4:46830961-46830983 GGGCTCCCACAGTGCAGTGTCGG - Intronic
974278574 4:59759606-59759628 GGCCTCCCACTCCACAGAGTAGG - Intergenic
975033947 4:69658365-69658387 GGGCCCCCACAGCACAGTGGTGG + Intergenic
975403307 4:73962182-73962204 GGCTTCACACAGCACAGGGTGGG - Intergenic
975658102 4:76661482-76661504 GGCCTCCCAAAGCGCTGGGTGGG + Intronic
976299390 4:83503773-83503795 GGCCTCCCAAAGTGCTGTGCTGG + Intronic
976753571 4:88475569-88475591 GGCCTCCCAAAGTACTGGTTAGG + Intronic
977302835 4:95287648-95287670 GGCCTCCCAGAGTCCTGTGTTGG - Intronic
977439197 4:97040602-97040624 AGCCTCCCAAAGCACTGGGAGGG + Intergenic
977819317 4:101453677-101453699 GGCCTCCCAAAGTGCTGGGTGGG + Intronic
984584657 4:181549486-181549508 GGCCTAACACAGACCTGTGTTGG - Intergenic
985323027 4:188735340-188735362 AGCCTGCCACTGCACTGTGGGGG - Intergenic
985360962 4:189174999-189175021 GGGCTCCCACTGCACTCTGCAGG + Intergenic
985550225 5:528919-528941 GGCCTCCCAGAGCGCTGGGCTGG - Intergenic
986016572 5:3762666-3762688 GGGCTGCCCCAGCTCTGTGTTGG + Intergenic
991582732 5:68173734-68173756 GGCCTCCCAAAGTGCTGTGGAGG - Intergenic
992474411 5:77088098-77088120 GCCCTCCCACAGCCCTTTGCAGG + Intergenic
994146836 5:96404679-96404701 AGCCTCCCACAGCCCTGTGAGGG - Intronic
994760078 5:103841150-103841172 TGACTCCCACAGCAGTCTGTGGG - Intergenic
995679928 5:114704728-114704750 GGGCTCCCACAGTGCAGTGTGGG + Intergenic
999770694 5:154773529-154773551 GTTCCCCCACAGCACTGTGCTGG + Intronic
1000919779 5:167124325-167124347 TGACTCCCACAGCAATTTGTTGG + Intergenic
1001451240 5:171826189-171826211 GGCAGCCCACTGCAGTGTGTTGG - Intergenic
1004167496 6:13269896-13269918 TGCCTCACACAGAAATGTGTGGG - Intronic
1004368115 6:15029093-15029115 GGCCTCAGGCAGCACTGTGTGGG - Intergenic
1004595414 6:17094803-17094825 AGCCTCCCAAAGCGCTGTGATGG + Intergenic
1006168055 6:32077145-32077167 GGCCTCACAGAGCCCAGTGTGGG + Intronic
1006867730 6:37222557-37222579 GGCCTCCCACTTCACTGAGCAGG - Intronic
1007472658 6:42100816-42100838 GGCCTCCCAAAGTGCTGGGTGGG - Intergenic
1008644942 6:53504562-53504584 GGTCACCCACAGAACTCTGTGGG - Intronic
1011192023 6:84739191-84739213 GGCCTCTCCCTGCAGTGTGTGGG + Intronic
1013082775 6:106826924-106826946 GGCCTCCCAAAGCACTGGCATGG - Intergenic
1016184633 6:141183437-141183459 GGGCCCCCACAGCACAGTGGTGG - Intergenic
1017220378 6:151959525-151959547 AGCCTCCCACTGCACAGCGTTGG - Intronic
1019437479 7:1029515-1029537 GGCCTCCTAAAGCACTGACTGGG + Intronic
1020430569 7:8112858-8112880 GGGCTTCCACAGATCTGTGTGGG + Intergenic
1021018273 7:15563586-15563608 GGCCTCCCAAAGTACTGGCTGGG - Intergenic
1021654466 7:22861805-22861827 GGCCTCCCAAAGTGCTGGGTGGG - Intergenic
1024178478 7:46864092-46864114 GGCCTCCCAGGGCACAGTGAAGG - Intergenic
1025620891 7:63169772-63169794 GGCCTAACAAAGCACTGAGTAGG + Intergenic
1026540304 7:71274532-71274554 GGCCTCCAAAAGCGCTGGGTTGG + Intronic
1029117759 7:98246120-98246142 CACCGCCCACAGCACTGAGTTGG + Exonic
1029683279 7:102127457-102127479 GGCCTCCCAAAGTGCTGAGTGGG + Intronic
1030228912 7:107184762-107184784 GGCCTCCCAAAGTGCTGGGTGGG + Intronic
1031636087 7:124102878-124102900 GACTTCCCACAACACTGTTTGGG - Intergenic
1033205124 7:139413521-139413543 GGCCTCCCAAAGAGCTGTGATGG - Intronic
1033681914 7:143603220-143603242 GGCCTCCCATATCCCAGTGTGGG - Intergenic
1033702975 7:143858693-143858715 GGCCTCCCATATCCCAGTGTGGG + Intronic
1034515842 7:151578683-151578705 GCTCTCCCACATCACTGGGTTGG - Intronic
1034562535 7:151890503-151890525 TGCCTCCCACCTCACTGCGTGGG + Intergenic
1036530377 8:9579721-9579743 GGCCTCACACAGTGCTGTGAGGG + Intronic
1037742752 8:21620504-21620526 GGCCTCCCAGAGCACACAGTAGG + Intergenic
1037988119 8:23302266-23302288 GGCATCCCACCCCACTGTGTGGG + Intronic
1039054950 8:33528570-33528592 GGCCTCCCAAAGTGCTGGGTTGG + Intergenic
1040506558 8:48054057-48054079 GGCCTCCCAGAGTGCTGGGTGGG + Intronic
1040638763 8:49306433-49306455 GGGCCCCCACAGCACAGTGGTGG - Intergenic
1042008578 8:64211715-64211737 TGCATCTCACAGCACTGTCTGGG - Intergenic
1043731997 8:83694395-83694417 GGACTCCCACAGCGCAGTGGCGG + Intergenic
1044618755 8:94168391-94168413 GGCCTCCCAAAGTGCTGGGTGGG + Intronic
1048011386 8:130459286-130459308 GGCCTCCCAAAGTGCTGGGTGGG - Intergenic
1048941418 8:139403768-139403790 GGCCTCCCAAAGTGCTGTGCTGG - Intergenic
1049349475 8:142156626-142156648 TGCCTTCCACTGCCCTGTGTGGG + Intergenic
1049928909 9:437308-437330 GGCTTCCCACACCACAGTTTAGG + Intronic
1051284409 9:15481441-15481463 AGCCTCCCAAAGCGCTGAGTGGG - Intronic
1051779864 9:20678578-20678600 GGCCTCCTGCAGCACTGTGAAGG - Intronic
1054302821 9:63390631-63390653 GCCTTACCAGAGCACTGTGTTGG + Intergenic
1055470427 9:76605081-76605103 GGTCTCCCAAAGCGCTGTGCTGG + Intergenic
1056035687 9:82602431-82602453 GCCCTCCCACTGCACTGAGTAGG + Intergenic
1056327752 9:85494284-85494306 GGCCTCCCAAAGTTCTGTGTTGG - Intergenic
1057118100 9:92545165-92545187 GAGCTCCCACAGCACAGCGTGGG - Intronic
1061070601 9:128307940-128307962 TGCCTCCCAAAGCACTGGGATGG - Intergenic
1061117990 9:128626719-128626741 GGCCTCCCAGAGCCCTCTCTGGG + Intronic
1062001237 9:134216767-134216789 GGCCTCCCACAGCCCTCTGCGGG + Intergenic
1062037162 9:134387515-134387537 AGCCTTCCTCAGCACTGCGTGGG + Intronic
1062081549 9:134626685-134626707 GGCCTGCCACATCACTGGGAGGG + Intergenic
1062402843 9:136379990-136380012 GGCCTCCCACACGCCTCTGTAGG + Intronic
1186467469 X:9794973-9794995 GTTCTCCCACAGCACTCTGAAGG + Intronic
1186885026 X:13904461-13904483 TGCCTCCAACAGGACTGTGGGGG - Intronic
1190070276 X:47273728-47273750 GGGCTCCCTCCTCACTGTGTGGG + Intergenic
1190919998 X:54841804-54841826 GGCCTCCCCCAGAGCTGTGGAGG - Intergenic
1192743969 X:73920403-73920425 GGCCTCCCAAAGTGCTGTGCTGG - Intergenic
1194077662 X:89417045-89417067 AGCCTGCCACTGCACTGTGGGGG + Intergenic
1194173542 X:90618202-90618224 AGCCCACCACTGCACTGTGTGGG - Intergenic
1197563203 X:128049363-128049385 GGCCTCCCAAAGTGCTGTGCTGG - Intergenic
1198975015 X:142326986-142327008 GGCCAGCCAAAGCACTTTGTAGG + Intergenic
1199666835 X:150102902-150102924 GGCCTCGCTCAGAACTGTGCTGG - Intergenic
1202018318 Y:20435147-20435169 GGCCACCCTGAGCACTGGGTGGG - Intergenic
1202242414 Y:22785509-22785531 AGCCTGCCACTGCACTGTGGGGG + Intergenic
1202395399 Y:24419258-24419280 AGCCTGCCACTGCACTGTGGGGG + Intergenic
1202475386 Y:25250834-25250856 AGCCTGCCACTGCACTGTGGGGG - Intergenic