ID: 1161354967

View in Genome Browser
Species Human (GRCh38)
Location 19:3813836-3813858
Sequence GTCCTCCCGCATCAGAGGTG AGG
Strand +
Crispr in exon? Yes
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 86
Summary {0: 1, 1: 0, 2: 1, 3: 4, 4: 80}

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1161354965_1161354967 -6 Left 1161354965 19:3813819-3813841 CCTGGGTCTGTGGAGGGGTCCTC 0: 1
1: 0
2: 2
3: 25
4: 198
Right 1161354967 19:3813836-3813858 GTCCTCCCGCATCAGAGGTGAGG 0: 1
1: 0
2: 1
3: 4
4: 80
1161354963_1161354967 -1 Left 1161354963 19:3813814-3813836 CCGCACCTGGGTCTGTGGAGGGG 0: 1
1: 1
2: 3
3: 57
4: 394
Right 1161354967 19:3813836-3813858 GTCCTCCCGCATCAGAGGTGAGG 0: 1
1: 0
2: 1
3: 4
4: 80

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1161354967 Original CRISPR GTCCTCCCGCATCAGAGGTG AGG Exonic
900573654 1:3372370-3372392 TTCCTCCCGCATCTGCTGTGGGG + Intronic
903184117 1:21619814-21619836 GGACTCCGGCATCAGAGATGGGG + Intronic
903443884 1:23408373-23408395 GTGCCCCCGAATCAGGGGTGTGG - Intronic
904608366 1:31711306-31711328 GTTCTCCTGGAGCAGAGGTGAGG + Intergenic
905239909 1:36574937-36574959 CTCCTCCAGAATCAAAGGTGAGG - Intergenic
1077028437 11:452023-452045 GTCCTCCCGCAGCACAGCTGGGG + Intronic
1077195514 11:1278004-1278026 GTCCTCCCGCATCAGACATGGGG - Intronic
1077677327 11:4206704-4206726 GTCCTCCAGCATCAGAATGGTGG + Intergenic
1078514205 11:12008864-12008886 GGGCTCCAGCATCACAGGTGAGG - Exonic
1080515357 11:33015273-33015295 CTACCCCCGCATCACAGGTGAGG + Intergenic
1084679888 11:70660818-70660840 GGCCTCCTGCAGCACAGGTGCGG + Intronic
1085052197 11:73385525-73385547 GGCCTCCCGCTTCAGACATGGGG + Intronic
1102405169 12:112667111-112667133 GTCCTGCAGCAGAAGAGGTGAGG - Intronic
1103326469 12:120124658-120124680 GTCCTCCCGCATCACAGTGTTGG + Intergenic
1103440583 12:120959893-120959915 GTCATCACGCATCATAGCTGGGG + Intergenic
1105439630 13:20404549-20404571 GCCCACCCGCTGCAGAGGTGAGG + Intronic
1113770714 13:112906752-112906774 TTCCTTGCGCAGCAGAGGTGAGG + Intronic
1116792649 14:49356482-49356504 GTCCTCCAGGATCTGAGGTTTGG + Intergenic
1121502374 14:94448469-94448491 GCCCTCCAGGATCAGAGCTGAGG + Exonic
1122743591 14:103885569-103885591 GTCCTCCCACAGCCGAGGTCAGG + Intergenic
1124890139 15:33725237-33725259 GTCCTGCCCTATCAGTGGTGAGG + Intronic
1126038523 15:44569500-44569522 GTCCTCCCACTTCACAGGTACGG - Exonic
1127892161 15:63262591-63262613 TTCCCCCCGCCTCAGAGATGGGG - Intronic
1129751602 15:78069122-78069144 GTCCACCCCCCTCAGACGTGAGG + Intronic
1131119367 15:89813461-89813483 CTGCTCCCGCTTCACAGGTGGGG - Intronic
1135962080 16:27003403-27003425 CTTCTCCAGCAGCAGAGGTGAGG - Intergenic
1139597435 16:67966631-67966653 GGCCTCCCAGAGCAGAGGTGTGG + Intronic
1141712086 16:85705597-85705619 GTCCTCTCACAACAGAGTTGGGG - Intronic
1144212133 17:13024573-13024595 GTTCTCCCGGGTCAGAGGAGGGG + Intergenic
1146125179 17:30225715-30225737 GTCATTCCACAGCAGAGGTGGGG - Intronic
1148457621 17:47819544-47819566 GTGCTCTCCCATTAGAGGTGAGG + Intronic
1150847289 17:68672313-68672335 TTCCCCCCCCATCAGAGGTATGG - Intergenic
1151439728 17:74120362-74120384 GGGCTCCCAGATCAGAGGTGTGG + Intergenic
1161354967 19:3813836-3813858 GTCCTCCCGCATCAGAGGTGAGG + Exonic
1162585298 19:11554501-11554523 GTCCTCCTGCATCAGGACTGAGG - Intronic
1163194168 19:15702964-15702986 TTCTTCCCCCATCAGAGCTGGGG + Intergenic
1165213644 19:34254459-34254481 CTCCTCTCGCATTAGAGGGGAGG - Intergenic
1166592252 19:44009772-44009794 GTCCTCCCGCATGATATGTCAGG + Intronic
1167877490 19:52426512-52426534 TTCCTCCCGCATCACAGCTGAGG + Intergenic
925407593 2:3616028-3616050 GCCGCCCCGCCTCAGAGGTGAGG - Intronic
926695192 2:15766053-15766075 GTCCCCCCTCAACAGAGGTGAGG + Intergenic
929687869 2:44049932-44049954 CTCCTCTTTCATCAGAGGTGTGG - Intergenic
933809980 2:86027124-86027146 GGCCTCCTGCAGCACAGGTGAGG + Exonic
937980580 2:127612306-127612328 GTCCTCCCGGATCACAGGCCAGG + Intronic
941740095 2:169026728-169026750 GTCCTCCAGCATCTGATGTATGG - Intronic
942483842 2:176418906-176418928 TTCTTCCAGCATCAGTGGTGTGG - Intergenic
1171334815 20:24374048-24374070 GTCCTCTCCCTCCAGAGGTGAGG + Intergenic
1172828099 20:37807383-37807405 GCCCTCCCACAGTAGAGGTGTGG - Intronic
1175001715 20:55636325-55636347 GTCCACTAGCATTAGAGGTGAGG - Intergenic
1177643141 21:23869769-23869791 GTCATCCGGTATCAGAGGTCAGG - Intergenic
1177643281 21:23871362-23871384 GTCATCCGGTATCAGAGGTCAGG - Intergenic
1179173355 21:38990126-38990148 GAGCTCCTGCATCAGAGCTGCGG - Intergenic
1180951041 22:19720757-19720779 CTCCTCCCGGATCTGTGGTGGGG - Exonic
1182288028 22:29259467-29259489 GCCCTCCCGCATCTCAGGTTGGG + Exonic
1184326635 22:43792649-43792671 TTCTTCCCACATCATAGGTGAGG + Intronic
1184875959 22:47275741-47275763 GTCCCCCAGCCCCAGAGGTGAGG + Intergenic
1185142121 22:49108352-49108374 CTCCTCCCTCAGCAGAGCTGGGG + Intergenic
960505434 3:118487875-118487897 GTCCTCCCTAGTCTGAGGTGGGG + Intergenic
968815594 4:2820084-2820106 GTCCTCCAGCATCTGAGGCTTGG + Intronic
968867672 4:3224201-3224223 GTCTTCCCGCATCACTGGTGTGG - Intronic
969152837 4:5185035-5185057 CTCCTCCAGCGTCAGACGTGAGG + Intronic
982717516 4:158824534-158824556 GAGCTCCAGCAGCAGAGGTGGGG - Intronic
985676185 5:1232407-1232429 GCCCTCCTGGATGAGAGGTGGGG + Intronic
985711163 5:1430760-1430782 ATCCTCCCCCAGCAGAGGCGAGG + Intronic
1001872287 5:175167303-175167325 ATCCTCCCACATCAGACATGCGG - Intergenic
1005292317 6:24391971-24391993 ATCCTCCCACATCAAAGCTGAGG + Intergenic
1007813828 6:44506013-44506035 GTCCTGCCTGATTAGAGGTGAGG - Intergenic
1018858876 6:167696345-167696367 GCCCTCCCCCATCAGAGGATGGG - Intergenic
1021189351 7:17602444-17602466 GCTCTCCCCCATCACAGGTGTGG + Intergenic
1022307127 7:29157211-29157233 TTCCTCCCCACTCAGAGGTGTGG - Intronic
1023368873 7:39492108-39492130 GTCCTCCGGCATAAGGGTTGAGG + Intronic
1023376138 7:39557454-39557476 CTCCTCCTCCAACAGAGGTGGGG + Intergenic
1035216466 7:157371369-157371391 GACCTCCCTCATGATAGGTGGGG + Intronic
1035284564 7:157797883-157797905 GTCCTCCAGCTTGAGAGCTGCGG - Intronic
1037766325 8:21774577-21774599 GTACTCCCCCATCACAGCTGAGG + Intronic
1037835445 8:22212547-22212569 GTCCTCCCACATGAGGGGAGGGG + Intergenic
1040689788 8:49922442-49922464 GTCTGCCCTCATCAGTGGTGAGG - Intronic
1052302638 9:26971435-26971457 GACCTCCCTCATGAGAGGTTTGG + Intronic
1053363380 9:37505323-37505345 GTCTTCCTTCAGCAGAGGTGTGG + Intergenic
1055051988 9:71990396-71990418 GACCTCCCGAATCAGAGTTATGG + Intergenic
1060518327 9:124279629-124279651 GTCCTCCCACTGCACAGGTGGGG - Intronic
1060938681 9:127530789-127530811 CTCCTCCACCATCAGAGCTGGGG - Intronic
1062364814 9:136203503-136203525 GTCCTCCCGCCGCTGAGGTTTGG + Intronic
1190320914 X:49178730-49178752 AGCCTCCCTCATCAGGGGTGGGG + Intronic
1199084742 X:143615693-143615715 GTCCTGCCCCAACAGAGATGAGG - Intergenic
1200246721 X:154530447-154530469 TTCCACCCGCAGCACAGGTGAGG - Intergenic