ID: 1161357596

View in Genome Browser
Species Human (GRCh38)
Location 19:3827563-3827585
Sequence GCCCAACGGGAGCCCGCGCG GGG (reversed)
Strand -
Crispr in exon? Yes
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 78
Summary {0: 1, 1: 0, 2: 0, 3: 6, 4: 71}

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1161357596_1161357602 -4 Left 1161357596 19:3827563-3827585 CCCCGCGCGGGCTCCCGTTGGGC 0: 1
1: 0
2: 0
3: 6
4: 71
Right 1161357602 19:3827582-3827604 GGGCTGCACGCCTGTCTTCTGGG 0: 1
1: 0
2: 1
3: 15
4: 156
1161357596_1161357601 -5 Left 1161357596 19:3827563-3827585 CCCCGCGCGGGCTCCCGTTGGGC 0: 1
1: 0
2: 0
3: 6
4: 71
Right 1161357601 19:3827581-3827603 TGGGCTGCACGCCTGTCTTCTGG 0: 1
1: 0
2: 1
3: 14
4: 132

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1161357596 Original CRISPR GCCCAACGGGAGCCCGCGCG GGG (reversed) Exonic