ID: 1161364066

View in Genome Browser
Species Human (GRCh38)
Location 19:3868456-3868478
Sequence TGACCCCTGATTGCTGGTAG GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1161364066_1161364076 15 Left 1161364066 19:3868456-3868478 CCCCTACCAGCAATCAGGGGTCA No data
Right 1161364076 19:3868494-3868516 TCCCCACCCACTCCCCGGCCAGG 0: 1
1: 0
2: 1
3: 72
4: 591
1161364066_1161364082 26 Left 1161364066 19:3868456-3868478 CCCCTACCAGCAATCAGGGGTCA No data
Right 1161364082 19:3868505-3868527 TCCCCGGCCAGGCACCTCCCAGG 0: 1
1: 0
2: 0
3: 53
4: 326
1161364066_1161364073 10 Left 1161364066 19:3868456-3868478 CCCCTACCAGCAATCAGGGGTCA No data
Right 1161364073 19:3868489-3868511 GCCCATCCCCACCCACTCCCCGG 0: 1
1: 0
2: 11
3: 82
4: 730

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1161364066 Original CRISPR TGACCCCTGATTGCTGGTAG GGG (reversed) Intronic
No off target data available for this crispr