ID: 1161366099

View in Genome Browser
Species Human (GRCh38)
Location 19:3880701-3880723
Sequence CTGGGAAGAAGCAGCTACCT CGG
Strand +
Crispr in exon? Yes
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 306
Summary {0: 1, 1: 0, 2: 2, 3: 30, 4: 273}

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1161366092_1161366099 -1 Left 1161366092 19:3880679-3880701 CCGAGCCTCTGCCAGCCCTGAGC 0: 1
1: 1
2: 3
3: 75
4: 621
Right 1161366099 19:3880701-3880723 CTGGGAAGAAGCAGCTACCTCGG 0: 1
1: 0
2: 2
3: 30
4: 273
1161366095_1161366099 -6 Left 1161366095 19:3880684-3880706 CCTCTGCCAGCCCTGAGCTGGGA 0: 1
1: 2
2: 5
3: 71
4: 644
Right 1161366099 19:3880701-3880723 CTGGGAAGAAGCAGCTACCTCGG 0: 1
1: 0
2: 2
3: 30
4: 273
1161366091_1161366099 13 Left 1161366091 19:3880665-3880687 CCGTCTTCGGGAAGCCGAGCCTC 0: 1
1: 0
2: 0
3: 9
4: 76
Right 1161366099 19:3880701-3880723 CTGGGAAGAAGCAGCTACCTCGG 0: 1
1: 0
2: 2
3: 30
4: 273

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1161366099 Original CRISPR CTGGGAAGAAGCAGCTACCT CGG Exonic
901486860 1:9569666-9569688 CTGGGAAATAGGAGCTACTTGGG - Intronic
901633320 1:10658388-10658410 ATGGGAGGAGGCAGCTACCTTGG + Intronic
902091378 1:13906494-13906516 CTGAGAAGATGCTGCTGCCTGGG + Intergenic
903737347 1:25538512-25538534 CCTGGAAGAAGCAGCTGCATGGG + Intergenic
905042095 1:34968212-34968234 CTGGGAAGAAGCTGCAATCTTGG + Intergenic
905996772 1:42388122-42388144 GGGGGAAGAAGCAGATACATAGG + Intronic
907334128 1:53689359-53689381 CTGGCAAGAAGCATTTACCCTGG + Intronic
907416798 1:54320041-54320063 CTGGCATGAAGCAGGTACCTGGG - Intronic
908327180 1:63034588-63034610 CTAGGATGAAGCTGATACCTTGG + Intergenic
911912137 1:103650417-103650439 CTGGGGAGAATCAGCTGCCTGGG + Intergenic
911916317 1:103701531-103701553 CTGGGGAGAATCAGCTGCCTGGG - Intronic
911919552 1:103744555-103744577 CTGGGGAGAATCAGCTGCCTGGG + Intronic
912805589 1:112754585-112754607 CAGGGAAGGAGCAACTACCTGGG - Intergenic
912816274 1:112831255-112831277 ATGGGAAGACTCAGCTGCCTTGG + Intergenic
915196753 1:154195237-154195259 CAGGGGAGAAGCAGCTGTCTTGG + Intergenic
916395869 1:164386769-164386791 GTGGGAAGAAGCATCTGCCCCGG + Intergenic
916956836 1:169846440-169846462 ATTGGAAGAAGATGCTACCTAGG - Intronic
916962403 1:169902485-169902507 CAAGGAAGAAGCAGCTAGATCGG + Intergenic
917353220 1:174099962-174099984 CTTGGAAGAAGAAGCCATCTGGG - Intergenic
918170121 1:181988533-181988555 CTGGGAACCAGCAGCTTCTTGGG - Intergenic
918984771 1:191609369-191609391 CCAGGAAGAAGCAACTTCCTGGG - Intergenic
919804796 1:201375201-201375223 CTGGGCAGTGGCAGCTCCCTTGG - Intronic
921991240 1:221370135-221370157 TGGGGACGAAGAAGCTACCTGGG + Intergenic
922036300 1:221851857-221851879 ACAGGAAGAAGCAGCTATCTTGG - Intergenic
923181453 1:231523869-231523891 CTGGGAAGAAGTGGCTACTGAGG + Intergenic
923206426 1:231763151-231763173 CTGGGAAAGAGCAGGAACCTGGG + Intronic
1062903403 10:1162823-1162845 CTGGGCAGAAGCAGTTAGCAGGG + Intergenic
1064254510 10:13732590-13732612 CCGGGCAGGAGCAGCTGCCTGGG + Intronic
1065313798 10:24442147-24442169 GTGGGAGGCAGCAGTTACCTTGG - Intronic
1066435505 10:35393634-35393656 CTGTGAAGAGGCAGCTCACTAGG + Intronic
1066661294 10:37740070-37740092 CTGTGCACAACCAGCTACCTGGG - Intergenic
1066661808 10:37743914-37743936 CTGAGAAAAGGCATCTACCTCGG - Intergenic
1068410881 10:56652896-56652918 CTGGGAAGATGCAAAAACCTGGG + Intergenic
1069965674 10:72113391-72113413 CTGGGAAGATGCACCTTCCCTGG - Intronic
1070306926 10:75245280-75245302 TTGGGAAGCAGCAGAGACCTGGG + Intergenic
1070575617 10:77675676-77675698 CTGGGAAGAAGCATCTAGCGAGG - Intergenic
1072172439 10:92878619-92878641 CCAGGAAGAAGCAACTTCCTGGG - Intronic
1074825956 10:117216092-117216114 CAGGCAAGAAGCAGCCCCCTGGG - Intergenic
1074951044 10:118336340-118336362 CTCGGAAGATGAAGCTACGTTGG - Exonic
1075186088 10:120259070-120259092 ATTGGAAGAAGCTGCCACCTAGG - Intergenic
1077703017 11:4459099-4459121 TTGGGAAGAGGCAGCTTGCTTGG - Intergenic
1078436902 11:11332867-11332889 TTGGGGAGAAGCTGCAACCTGGG - Intronic
1078571032 11:12458203-12458225 CTGGGAAGAGACACCTTCCTGGG - Intronic
1078823878 11:14907763-14907785 AGGGGAAGAAGCAGATACCAGGG + Intronic
1078975798 11:16474844-16474866 ATGGGAAGAAGATGCTATCTAGG - Intronic
1079684379 11:23339037-23339059 CTAGGTAGAATCAGTTACCTGGG - Intergenic
1079907201 11:26263478-26263500 CTGGGAAGGAGCAGCTTTCTTGG - Intergenic
1080301123 11:30785916-30785938 GTGTGAAAAAGCAGCTTCCTGGG - Intergenic
1081200784 11:40212864-40212886 CTGGGAAGCAGCAGTAACTTGGG + Intronic
1083090207 11:60191732-60191754 GTGGGAAGACCCAGCTGCCTTGG + Intergenic
1084170050 11:67396704-67396726 CTGGGAGGCAGGAGCTGCCTGGG + Intronic
1084266224 11:68006718-68006740 GTGGAAAGCAGCAGCCACCTGGG - Intergenic
1086777188 11:90852666-90852688 TTGTGATGAAGAAGCTACCTGGG + Intergenic
1091757884 12:3067135-3067157 CCAGGGAGAAGCAGCTTCCTGGG + Intergenic
1093166271 12:15807526-15807548 CTGAGAAGCAGCAGCTACTAGGG + Intronic
1093940096 12:25043499-25043521 CTGGAAAGAAGCTGAGACCTAGG - Intronic
1094131759 12:27082342-27082364 CTGGGAAGATGCACCTTCCAAGG - Exonic
1094181158 12:27593898-27593920 CTGGGAAGACGCACCTTCCAAGG - Intronic
1096124208 12:49107774-49107796 CTGGGCAGCAGCAGCTTACTTGG - Intronic
1096769533 12:53926068-53926090 CTGGCAAGAATCATCTGCCTAGG - Intergenic
1097547974 12:61028719-61028741 GTGGACAGAAGCATCTACCTGGG + Intergenic
1097849396 12:64396606-64396628 CTGGCAAGAAGCAGCTCCTATGG + Intergenic
1098166745 12:67706232-67706254 TTGGGAGGAAGCGGCTACTTGGG + Intergenic
1098248717 12:68546506-68546528 GTGGGAAGACTCAGCTGCCTTGG + Intergenic
1098284105 12:68890833-68890855 CTAGGGAGAAGCAGAGACCTTGG + Intronic
1099833298 12:87873511-87873533 CTGCCAAGAAGCTACTACCTTGG - Intergenic
1102112298 12:110373704-110373726 CTGGGAACAGGAAGCTCCCTAGG + Exonic
1102998191 12:117365415-117365437 CTGGGAAGAAGGGGGTTCCTGGG + Intronic
1103513467 12:121490992-121491014 ATGGGAGGAAGCTGCAACCTGGG + Intronic
1103606355 12:122088603-122088625 GTGGGTAGAAGCAGCCGCCTGGG + Intronic
1104771252 12:131366218-131366240 TGGGGAAGAAGCAGCCACCTGGG - Intergenic
1106117787 13:26831940-26831962 CTGGGGAGAAGCACATAGCTAGG - Intergenic
1108700606 13:52941015-52941037 CTGGTAGGAAACAGCTATCTCGG + Intergenic
1110037954 13:70712742-70712764 TTGGGTAGAAGCAAGTACCTAGG + Intergenic
1113609805 13:111636260-111636282 CTGGGAAGAAGCCGCTCCTCTGG - Intronic
1113713008 13:112482984-112483006 ATGGGAAGAAGATGCTATCTAGG - Intergenic
1114042988 14:18695986-18696008 CTGAGAAGAAGGAGCGAGCTGGG + Intergenic
1114047279 14:18886426-18886448 CTGAGAAGAAGGAGCGAGCTGGG + Intergenic
1114116936 14:19632971-19632993 CTGAGAAGAAGGAGCGAGCTGGG - Intergenic
1114227266 14:20750443-20750465 CTGGGGAGGAGCAGACACCTGGG + Intergenic
1114230245 14:20774835-20774857 CTGGGGAGGAGCAGACACCTGGG + Intergenic
1114776478 14:25487980-25488002 TTGGGAAGAAACAGCAACCTTGG - Intergenic
1116660247 14:47701011-47701033 CCGGGAAGAAGCTGAGACCTTGG - Intergenic
1118445076 14:65843381-65843403 TTGGGTAGAAGCTGCTGCCTTGG - Intergenic
1118508510 14:66443764-66443786 TTGGGAAGAAGCTGGTACTTGGG + Intergenic
1118603384 14:67486062-67486084 CTGGGAAACAGCATCTACTTTGG - Intronic
1118696913 14:68394673-68394695 CTGGGATAAAGTAGATACCTTGG - Intronic
1119004103 14:70908242-70908264 CTGGGAAGCGGCAGCGTCCTAGG + Intronic
1119773242 14:77234436-77234458 TTGGGAAGATGTAGGTACCTCGG - Intronic
1120736901 14:88063670-88063692 GTGGTAAGAAGTAGCTACCAGGG - Intergenic
1120766580 14:88332959-88332981 GTGGCAAGAAGCAGATTCCTAGG + Intergenic
1121488529 14:94341041-94341063 CTGAGAAGCAGCAGCCAGCTGGG + Intergenic
1122740981 14:103871604-103871626 CTGGGGAGAAGGTGCTCCCTGGG + Intergenic
1125263460 15:37853056-37853078 CTGTGAAGAAGTAACAACCTAGG + Intergenic
1125600761 15:40914796-40914818 CTGGGAAGAATCAGTTCCCAAGG + Intergenic
1126858431 15:52861192-52861214 TTGGAAACAAGAAGCTACCTGGG - Intergenic
1128377313 15:67086442-67086464 CTGGGAAGGGGCAGCTAAGTTGG + Intronic
1130436431 15:83904162-83904184 GTGGGAAGAGGCAGCTGCTTGGG - Intronic
1130782038 15:87050448-87050470 CTGAGAACATGGAGCTACCTGGG - Intergenic
1130840835 15:87699925-87699947 CTGGGAAGAAGAAGAGACCTGGG + Intergenic
1131441881 15:92465681-92465703 GTGGGAAGAGGCGGGTACCTGGG - Exonic
1132945746 16:2530722-2530744 CAGGGAAGAACCACCTGCCTGGG + Exonic
1133274769 16:4630933-4630955 CTGGGAAAACCCAGCTACTTGGG - Intronic
1134213845 16:12300554-12300576 CTGGGGAAAAGCAGTTACATAGG - Intronic
1134278172 16:12795163-12795185 CTGGGCAGAAGCAGCTGTGTAGG + Intronic
1138422490 16:56908632-56908654 CTGGGCAGAGCCAGCTTCCTGGG - Intronic
1138442134 16:57041537-57041559 CTGGGAGGAAGCTGCCACCTCGG + Exonic
1138685944 16:58725772-58725794 CTGGGAAATAGAAGCTACTTTGG + Intronic
1139086997 16:63598973-63598995 CTTGGATGAAGCAGCTGTCTTGG + Intergenic
1139258362 16:65565428-65565450 CCGGCAATAAGCAGATACCTGGG + Intergenic
1140199426 16:72882395-72882417 CTGGGATGATGAAGCTACCAGGG - Intronic
1140332656 16:74072872-74072894 CTGGATAGAAGTTGCTACCTAGG - Intergenic
1142737314 17:1909057-1909079 GAGAGAAGAAGCAGCTACTTGGG - Intergenic
1143582643 17:7835692-7835714 CTGGGAGGCAGCAGCTGCCTGGG + Intergenic
1143712575 17:8744629-8744651 CTGTGAAGAGTCAGCTGCCTGGG - Exonic
1143772067 17:9175204-9175226 GTGGGAAAAGGCAGCTACTTGGG + Intronic
1146764483 17:35506902-35506924 GTGGGAAGACTCAGCTGCCTTGG + Intronic
1147361613 17:39934185-39934207 CTGGGAACAAGAACCTCCCTGGG + Intergenic
1147884447 17:43675416-43675438 CTGGCATTGAGCAGCTACCTAGG + Intergenic
1148619583 17:49024249-49024271 ATGGGAAGAAGAAATTACCTGGG + Intronic
1148803739 17:50252382-50252404 ATTGGAAGAAGATGCTACCTAGG - Intergenic
1148956869 17:51361418-51361440 CTGGGAAGAAGCCACTTCCTAGG - Intergenic
1149299103 17:55287849-55287871 CTGGTACAAAGCAGCTGCCTAGG - Intronic
1151364126 17:73606245-73606267 CTGGTGAGAGGCAGCTCCCTAGG + Intronic
1151578515 17:74964572-74964594 CTGGGCAGACACAGCCACCTCGG - Exonic
1151924242 17:77182413-77182435 GTGGGAGGAAGCAGTTACCCGGG + Intronic
1151925163 17:77190436-77190458 CTGGGAAGAATCAGTCACCCCGG - Intronic
1154303384 18:13213887-13213909 CAGGGAAGACTCAGCTACCCTGG + Intergenic
1155544213 18:26898796-26898818 CTGAGAAAAAGCAGTGACCTTGG + Intergenic
1156291283 18:35750586-35750608 CTGGGGAGAAGCAACTTCCTGGG - Intergenic
1159857956 18:73612170-73612192 GTGGGAAGAAGGAGCTTCTTGGG + Intergenic
1159881927 18:73866320-73866342 ATGGGAAGAAACAGTTATCTTGG - Intergenic
1160778950 19:869301-869323 CTGGACAGAAGCAGGTACATGGG + Intronic
1160779402 19:871169-871191 CTGGGGATAAGCAGCTGGCTGGG + Exonic
1160815911 19:1035620-1035642 CTGGGATGAAGCAGCCCCATGGG + Intronic
1160938479 19:1609049-1609071 CCGGGGAAAAGCAGCTCCCTGGG - Intergenic
1161366099 19:3880701-3880723 CTGGGAAGAAGCAGCTACCTCGG + Exonic
1162440108 19:10687478-10687500 CTGGGAAGAAGCAGCCGCACGGG + Exonic
1162826378 19:13254903-13254925 CTGGGAAGAAGAAGCTGGCCGGG + Intronic
1163121837 19:15223055-15223077 CTGGGGAGGAGCACTTACCTGGG - Intergenic
1164216585 19:23155966-23155988 GTGGGAAGACTCAGCTGCCTTGG - Intergenic
1164481221 19:28612398-28612420 CTGGGAAGAATAAGCTAACAGGG - Intergenic
1164493567 19:28736654-28736676 CTGGGCAGAAGCAGCCAGCATGG - Intergenic
1165121684 19:33563062-33563084 CTGGGAAGAAGGGCCTGCCTTGG + Intergenic
1166499540 19:43330654-43330676 CTGGGCAGCAGCAGCCATCTGGG - Intergenic
1166772333 19:45291304-45291326 CTCAGAAGGAGCAGCTCCCTTGG - Intronic
1168048436 19:53810682-53810704 CTGTTAAGAAGCAGCTCCGTGGG + Exonic
927566493 2:24117909-24117931 CTGGGAAGGGACAGCTATCTTGG - Intronic
928455890 2:31421290-31421312 CTGGGAAGAAGCTGCTGCAGAGG - Intergenic
929432293 2:41897477-41897499 CCTGGAACCAGCAGCTACCTGGG + Intergenic
930092742 2:47543153-47543175 CTGTGAATAAGGAGCTACCAGGG + Intronic
930278128 2:49337680-49337702 CTGGCAATAGGAAGCTACCTGGG + Intergenic
932880752 2:75499756-75499778 GTGGGCAGAGGCAGCAACCTGGG - Intronic
932949916 2:76280964-76280986 CAGGGAAGCAGCAGCAACCAGGG + Intergenic
935604791 2:104959644-104959666 ATGAGATGAAGCAGGTACCTTGG + Intergenic
937121281 2:119441481-119441503 CGGGTCAGAAGGAGCTACCTGGG - Intronic
937350702 2:121159015-121159037 CTAGGAAGAAGCAGCTAGCTGGG + Intergenic
937668519 2:124514655-124514677 CTGGGAAGAGGCAGCTGGATAGG + Intronic
938228170 2:129635693-129635715 ATGGGCAGAAGCAGCAGCCTGGG + Intergenic
938275654 2:130019194-130019216 GTGGGAGGATTCAGCTACCTTGG + Intergenic
938326600 2:130409919-130409941 ATGGGAGGATTCAGCTACCTTGG + Intergenic
938363339 2:130711541-130711563 ATGGGAGGATTCAGCTACCTTGG - Intergenic
944522419 2:200586039-200586061 CTGGGAAGTAGCGGGCACCTGGG - Exonic
945283463 2:208059513-208059535 CTGGGAATAAAGAGCTGCCTAGG + Intergenic
946032363 2:216715396-216715418 CTGGGAAGAAGGAGCTAGCTGGG + Intergenic
946672047 2:222115400-222115422 CTGGGAAGTAGCAGCATCTTTGG - Intergenic
947188287 2:227473163-227473185 CTGGGAGGAAGCAGGCACTTAGG + Intronic
947763938 2:232623972-232623994 CTGGGAGGATGGAGCTTCCTAGG + Intronic
1169460490 20:5790202-5790224 CTGGGAGGAAGAAGGTCCCTGGG - Intronic
1169570294 20:6898809-6898831 CTGGGAAGCAGCACCTGCCCAGG - Intergenic
1169977427 20:11345754-11345776 CTGGGAAGGAGAAGCTCCCGCGG - Intergenic
1170739939 20:19047179-19047201 CTAGGATGAAGAAGTTACCTGGG - Intergenic
1174170354 20:48613977-48613999 CTGGGAAGGAGCTGCTTCCCTGG - Intergenic
1174450532 20:50617319-50617341 CTGGGAAGAAGGGGCTGCCTTGG + Intronic
1175355874 20:58367660-58367682 CTGGGAAGCTTCAGATACCTTGG - Intergenic
1175784672 20:61705059-61705081 ATGGGAAGCAGCAGCTGGCTGGG - Intronic
1176134781 20:63517728-63517750 CTGGGCAGCAGCTGCCACCTGGG + Intergenic
1177612128 21:23465186-23465208 CAGGTGCGAAGCAGCTACCTTGG + Intergenic
1179657737 21:42855664-42855686 GTGAACAGAAGCAGCTACCTGGG + Exonic
1179861278 21:44190634-44190656 CTGAGAAGAAGTAGTTACCCAGG + Intergenic
1180465812 22:15609081-15609103 CTGAGAAGAAGGAGCGAGCTGGG + Intergenic
1181939820 22:26466448-26466470 CTGGGATGAAGCAAGAACCTGGG + Intronic
1183619922 22:38966336-38966358 CTGGGAAGCAGCAGCCACACAGG + Intronic
1184850830 22:47119304-47119326 CTGGAAAGAAGCAGCAGGCTTGG + Intronic
949493925 3:4613929-4613951 CTGGAAAGAAGCACCTTCTTGGG - Intronic
949537690 3:5008440-5008462 CTGGGAAGATGCAGCCCCATAGG - Intergenic
950187753 3:10955885-10955907 GTGGGAAGAAGGAGCCAGCTGGG + Intergenic
951027805 3:17847978-17848000 TGGAGAAGCAGCAGCTACCTGGG + Intronic
952297938 3:32077494-32077516 CCAGGGAGAAGCAGCTTCCTGGG + Intronic
952354964 3:32575498-32575520 CTGGGAAGGAACAGCTACCAAGG - Intergenic
954237910 3:49271107-49271129 CTGAGCAGAAGCAGCTACAATGG - Exonic
954347660 3:50013748-50013770 CTGAGAAGCAGCAGCAACCATGG + Intronic
954852406 3:53614772-53614794 CTAGCAAGATGCAGCTAACTTGG + Intronic
956524066 3:70138392-70138414 CAGGGAAAAAACAGCCACCTAGG - Intergenic
956747254 3:72319839-72319861 CTGGGATGAAGCAGGTCCTTCGG + Intergenic
956901465 3:73720714-73720736 CTGGGCTGAAGCAGATAACTAGG - Intergenic
957832241 3:85537291-85537313 CTATGTAGAAGCATCTACCTTGG + Intronic
958671955 3:97217519-97217541 CTTGGAAGCAGCACATACCTCGG - Intronic
960994928 3:123334314-123334336 CTGGGAAGGAGCACAGACCTTGG - Intronic
964932689 3:162045979-162046001 GTGGGAAGACTCAGCTGCCTTGG - Intergenic
965811411 3:172594528-172594550 CTGAACAGCAGCAGCTACCTGGG + Intergenic
966319967 3:178691386-178691408 GTGGGAAGAAGCAGATAATTGGG - Intronic
967019329 3:185508587-185508609 CTGGGAAGGAGCCCCTAACTAGG - Exonic
968703374 4:2067054-2067076 CTGGGCAGTGGCAGCTGCCTGGG - Exonic
969586910 4:8099210-8099232 CTGGGGAGAAGCAGAGACTTGGG + Intronic
973758326 4:54095996-54096018 CTGGAGGAAAGCAGCTACCTAGG - Intronic
974158940 4:58112239-58112261 CTTAGAAGAACCAGTTACCTAGG - Intergenic
974627853 4:64446745-64446767 CTAGGAAGAAGCAGCTTCTTGGG + Intergenic
976675893 4:87703063-87703085 CTAGGAAAAAGCAGATACTTTGG - Intergenic
977972705 4:103229999-103230021 GTGGGAAGACTCAGCTGCCTTGG + Intergenic
979862488 4:125711001-125711023 CTGGGAAAAGGCAGCCACCAGGG + Intergenic
981623473 4:146730595-146730617 TTGGGAAGAAGCAGCTAGTGAGG + Intronic
982068994 4:151678836-151678858 CTGAGATGAGGCAGCCACCTTGG + Intronic
984887618 4:184464679-184464701 CTGGGAAGACGTATCTCCCTAGG + Intronic
987131288 5:14862265-14862287 CTATGAAGAAGCAACTACATAGG + Intronic
989399050 5:40989634-40989656 TTGGGAACAAGCACCTATCTTGG + Intergenic
990354102 5:54948807-54948829 CTGGGAAGAGACACATACCTTGG - Intergenic
991311602 5:65249242-65249264 CTGGGGAGAAGCAACTTCCTGGG + Intronic
991947670 5:71915370-71915392 CTGAGAAGGAACATCTACCTTGG + Intergenic
994085846 5:95758388-95758410 CTGGAAAGCAGCAGATACCTAGG - Intronic
995521781 5:113014219-113014241 CTGGGACCCAGCAGCTACTTTGG + Exonic
997268014 5:132508894-132508916 CAGGGCTGAAGCAGCTACCTGGG + Intergenic
997632181 5:135377193-135377215 CTGGGAAGGAGAAGGTGCCTGGG + Intronic
998164071 5:139831981-139832003 CTGGGAAGGAGCAGGTGCTTCGG + Intronic
998370364 5:141656718-141656740 CTGTGAAGAGGCAGCCAGCTTGG + Exonic
1001244984 5:170099225-170099247 CTGGGAAGAATCTGTTTCCTTGG + Intergenic
1001916094 5:175561378-175561400 CTAGGAAGAAGCAACTGCCCGGG + Intergenic
1002211908 5:177604377-177604399 CTGGGAAGAAGACGCATCCTGGG + Exonic
1002456414 5:179347730-179347752 GTGGGAAGAATCAGCTGCCTGGG - Intergenic
1002998794 6:2311850-2311872 GTGGGAAGACTCAGCTGCCTTGG - Intergenic
1003328593 6:5111283-5111305 CTGGGATGGTTCAGCTACCTGGG + Intronic
1004877011 6:19966308-19966330 CTGGGAAGGAGCAGCAATCACGG + Intergenic
1005462253 6:26080278-26080300 GTGGGAAGACTCAGCTGCCTTGG + Intergenic
1005687319 6:28267268-28267290 CCGGGAAGCAGCTGCTCCCTAGG - Intronic
1007490094 6:42214080-42214102 CTTGGTATAAGGAGCTACCTTGG - Intronic
1007625049 6:43241429-43241451 CTTGGATGAGGCAGCTCCCTTGG + Intergenic
1007923770 6:45634529-45634551 CTGGGAAGCAGCAGCGTGCTGGG + Intronic
1008149886 6:47937801-47937823 CTTGGAAGAAGCAACTACATTGG + Intronic
1008457496 6:51727743-51727765 CCAGGAAGAAGCAACTTCCTGGG - Intronic
1009919397 6:70038825-70038847 ATGGGAAAAGGCAGCTAACTGGG - Intronic
1010141535 6:72620402-72620424 CTGGGCAGCAGAAGCTAGCTGGG - Intergenic
1011885225 6:92085708-92085730 CTGGGAATAAGCATCTAACTGGG + Intergenic
1013647895 6:112163449-112163471 CTGGGAAGAAACCGCTAGCCAGG + Intronic
1014742808 6:125166392-125166414 CTGGGAAGAAGTATAGACCTTGG + Intronic
1016752724 6:147649144-147649166 TTGGGTAGAAGCTGCTGCCTAGG - Intronic
1016910284 6:149192313-149192335 AAAGGAAGGAGCAGCTACCTAGG + Intergenic
1017444517 6:154495324-154495346 CTGGGAAGGAGCTGCTATGTGGG - Intronic
1017877332 6:158536063-158536085 GTGGGAAGAAGCACCTCACTTGG + Intergenic
1019630747 7:2048270-2048292 CGGAGAATGAGCAGCTACCTGGG + Intronic
1020070410 7:5223545-5223567 CTGGGCAGAAGCAGCAACACAGG - Intronic
1022474357 7:30700236-30700258 CTGGGTAGCAGCAGCTGTCTGGG - Intronic
1022585040 7:31600804-31600826 CCAGGAAGAAGCAACTTCCTGGG - Intronic
1022619939 7:31972771-31972793 AGGGGAAGAAGCACCTACCTGGG - Intronic
1024054037 7:45648224-45648246 CTGGGGAGAAGCAGCTGCTGGGG + Intronic
1028751571 7:94389423-94389445 CTGAGAAGGAGCAGCCACTTTGG - Intergenic
1029163676 7:98570947-98570969 CTCCCATGAAGCAGCTACCTGGG + Intergenic
1030711864 7:112758990-112759012 ATGGGCTGAAACAGCTACCTTGG - Intergenic
1031640782 7:124161475-124161497 CAGGGAAGCAGCAGGTCCCTAGG + Intergenic
1032056576 7:128689193-128689215 CTGGGCAGAAGCTGCAATCTCGG - Intergenic
1032265619 7:130368122-130368144 CTGCCAAGAAACAGCTCCCTGGG - Intronic
1033116004 7:138626165-138626187 CTGAGAAGCAGCACCTCCCTCGG - Intronic
1034292781 7:149945910-149945932 CCGGCAGGAAGCAGCTATCTGGG + Intergenic
1034813288 7:154150962-154150984 CCGGCAGGAAGCAGCTATCTAGG - Intronic
1034940156 7:155225436-155225458 CTGGGAAGAAGGAAATCCCTGGG - Intergenic
1035693751 8:1577752-1577774 CCAGGAAGGAGCAGCAACCTCGG + Intronic
1035990973 8:4489730-4489752 CAGGGAAGAAGCAGCTGCCGCGG + Intronic
1036394928 8:8361420-8361442 CAGGGCAGCAGCAGCTGCCTGGG + Intronic
1036707619 8:11056850-11056872 CTGGGAGGATGCAGCTCTCTTGG + Intronic
1037310386 8:17549416-17549438 CTGGGAACCAGCAGCTGCATGGG - Intronic
1038089989 8:24241865-24241887 GTGGGAAGACTCAGCTGCCTTGG + Intergenic
1039387965 8:37153119-37153141 CTTGGACGAAGCAGTTCCCTGGG + Intergenic
1042575041 8:70208505-70208527 GTTGGAAGAAGCAGCCATCTAGG + Intronic
1042754643 8:72197118-72197140 CTGGGAAGGAGCTGCTTCCAGGG + Intergenic
1043121178 8:76326586-76326608 CTGGCAGGAGGCATCTACCTCGG - Intergenic
1046491669 8:114960830-114960852 CTGGGAAGAACCTGCTTCCTGGG + Intergenic
1048297736 8:133227073-133227095 CTTGGATGAAGGAGCTACATAGG + Intronic
1049444789 8:142624928-142624950 CTAGGAAGGAGGAGCTCCCTGGG - Intergenic
1050138188 9:2490392-2490414 CTGAGAAGAAGCAGTGATCTAGG + Intergenic
1051001093 9:12282943-12282965 CTGGGAAGTAGAAGCTACTGTGG + Intergenic
1051222732 9:14867274-14867296 CAGGGAAAAAGAAGATACCTGGG - Intronic
1052508398 9:29383214-29383236 GTGGGAAGACTCAGCTGCCTTGG + Intergenic
1052819665 9:33128817-33128839 CTGGGGAGAAGCAGACTCCTGGG - Intronic
1053000831 9:34576612-34576634 TGGGGAAGAAGGAGCTGCCTGGG - Intronic
1053099097 9:35354356-35354378 CTAGGAAGAGACAGGTACCTGGG - Intronic
1055354193 9:75420373-75420395 GTGGGAAGATGCAGCTACACTGG + Intergenic
1056447280 9:86678128-86678150 CATGGATGAAGCAGCTAGCTTGG + Intergenic
1057287269 9:93767934-93767956 CTTGGAAGAAGAAGCCATCTAGG - Intergenic
1057779149 9:98035641-98035663 CTTGGAAGAAGCAGGTTCTTTGG + Intergenic
1059161559 9:112039818-112039840 CTGGGGTGGAGCAGCTACATGGG + Intergenic
1059297645 9:113286170-113286192 CTGGGAAGGAAAAGGTACCTTGG - Intronic
1061316059 9:129796487-129796509 CGGGGAAGCAGCAGCAACCTAGG + Intergenic
1061381488 9:130261287-130261309 CTGGGAAGATGAAGCTACCGAGG - Intergenic
1061622802 9:131822928-131822950 CTGGCCAGAAACAGGTACCTGGG - Intergenic
1061852748 9:133425456-133425478 CTGGGAGTCAGCAGCTGCCTGGG + Intronic
1186400549 X:9254942-9254964 CTGGGAATAAGCAGTTTCCAAGG - Intergenic
1186897781 X:14021596-14021618 CTGGGAAGAGGCAGTTCCTTGGG - Intronic
1187042975 X:15616550-15616572 CTTGCAAGAAACAGCTATCTGGG - Intergenic
1189119204 X:38375944-38375966 CTGAGAAGGAGCAACTACCAAGG + Intronic
1189417698 X:40829680-40829702 CAGGGCAGCAGCATCTACCTAGG + Intergenic
1189609454 X:42716085-42716107 CAGGGAAGAAGGAGCTGACTTGG + Intergenic
1190270602 X:48860332-48860354 GTGGGAAGACTCAGCTGCCTTGG + Intergenic
1190771561 X:53518995-53519017 GTGGGAAGACTCAGCTGCCTTGG + Intergenic
1191719811 X:64220091-64220113 CAGGGAAGAAGCAGCCTACTTGG + Intergenic
1191917640 X:66219994-66220016 GTGGGAAGACTCAGCTGCCTCGG - Intronic
1200164829 X:154028856-154028878 CAGGGAAGAGGGGGCTACCTAGG + Intronic
1201523718 Y:14906315-14906337 CTGGGAGGTCCCAGCTACCTGGG + Intergenic