ID: 1161366940

View in Genome Browser
Species Human (GRCh38)
Location 19:3885564-3885586
Sequence AAGAAGAAGGAGAAGGAGAG AGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 6202
Summary {0: 1, 1: 27, 2: 165, 3: 1019, 4: 4990}

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1161366937_1161366940 -6 Left 1161366937 19:3885547-3885569 CCGTCTCAAAAAAGAAGAAGAAG 0: 22
1: 92
2: 1116
3: 14082
4: 112783
Right 1161366940 19:3885564-3885586 AAGAAGAAGGAGAAGGAGAGAGG 0: 1
1: 27
2: 165
3: 1019
4: 4990
1161366935_1161366940 29 Left 1161366935 19:3885512-3885534 CCATTGCACTACAGCCTGGGCAA 0: 432
1: 39681
2: 113571
3: 184368
4: 217027
Right 1161366940 19:3885564-3885586 AAGAAGAAGGAGAAGGAGAGAGG 0: 1
1: 27
2: 165
3: 1019
4: 4990
1161366936_1161366940 15 Left 1161366936 19:3885526-3885548 CCTGGGCAACAGAGCAAGACTCC 0: 8345
1: 35403
2: 95445
3: 137050
4: 165011
Right 1161366940 19:3885564-3885586 AAGAAGAAGGAGAAGGAGAGAGG 0: 1
1: 27
2: 165
3: 1019
4: 4990

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1161366940 Original CRISPR AAGAAGAAGGAGAAGGAGAG AGG Intronic
Too many off-targets to display for this crispr