ID: 1161367621

View in Genome Browser
Species Human (GRCh38)
Location 19:3889825-3889847
Sequence GCCATTTGCACAGCCCATCT CGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 133
Summary {0: 1, 1: 0, 2: 0, 3: 9, 4: 123}

Found 0 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1161367621 Original CRISPR GCCATTTGCACAGCCCATCT CGG (reversed) Intronic
900086114 1:898193-898215 GCCACTTGCAGAGACCAGCTCGG + Intergenic
901023864 1:6268973-6268995 CCCACGTGCACAGCCCATGTGGG - Intronic
901469215 1:9443955-9443977 ACCATGGGCACAGCCCGTCTTGG + Intergenic
904592305 1:31621682-31621704 GCCATCAGCACATGCCATCTTGG + Intronic
907496956 1:54851620-54851642 GGCTTTGGCACAGCGCATCTGGG + Exonic
907892792 1:58651353-58651375 CCCATTTCAACTGCCCATCTTGG - Intergenic
910643075 1:89485404-89485426 GTCATTTTAACAGCCCATGTGGG + Intergenic
913661942 1:121012380-121012402 TCTCTTGGCACAGCCCATCTAGG - Intergenic
914013319 1:143795565-143795587 TCTCTTGGCACAGCCCATCTAGG - Intergenic
914164506 1:145165620-145165642 TCTCTTGGCACAGCCCATCTAGG + Intergenic
914651941 1:149704174-149704196 TCTCTTGGCACAGCCCATCTAGG - Exonic
915282151 1:154829869-154829891 CCCATTGGCACTGCCCAGCTGGG + Intronic
917516078 1:175709734-175709756 GCCTTTTGCTCAGCCCTTCTTGG + Intronic
918352722 1:183674188-183674210 GCTATTTGCTCAGACCATCTTGG - Intronic
920248468 1:204605975-204605997 GCCCTATGTCCAGCCCATCTGGG - Intergenic
920917931 1:210272996-210273018 TCCATTAGCACAGGCCAGCTGGG + Intergenic
924183420 1:241462201-241462223 GCCATTTGCACAGTCCATAGAGG + Intergenic
1063448422 10:6134758-6134780 TCCATCTGCACAGCCCTTCCTGG - Intergenic
1071567043 10:86676747-86676769 TGCATCTGCAGAGCCCATCTGGG + Intronic
1073969499 10:109031249-109031271 TCCACATGCACAGCCCAGCTGGG + Intergenic
1074269112 10:111935512-111935534 TCCATTTGCACAACTCAACTGGG - Intergenic
1075783623 10:125033255-125033277 GGCATCTTCACAGCCCAGCTGGG + Intronic
1076627995 10:131833704-131833726 GCCCTTTGCACATCGCAGCTGGG + Intergenic
1076775794 10:132697334-132697356 GCCACTGGCAAAGCCCATCTGGG + Intronic
1082301219 11:50508934-50508956 GCCATTTGCCAAGACCAGCTTGG - Intergenic
1083488433 11:62997853-62997875 GCTATGTGCACAGCCCGTTTTGG - Intronic
1083756012 11:64792054-64792076 GCCCTCTGCCCAGCCCAGCTGGG - Exonic
1084265818 11:68004604-68004626 CCCATTTGCACAGCCCAAACTGG - Intronic
1084769630 11:71334330-71334352 TCCATGTGCACAGCCCAGCGGGG - Intergenic
1089164133 11:116461757-116461779 GCCATTTTCTCAGCCCATTAAGG + Intergenic
1089261948 11:117229669-117229691 TCCAGGTGCACAGCCCAGCTCGG + Exonic
1090458672 11:126870667-126870689 TCTATTTGCACAGCTCATCTGGG + Intronic
1090662658 11:128892639-128892661 GCAAATTGCACAGCCTCTCTGGG - Intronic
1096278510 12:50231508-50231530 GCCATTTGCTCAGGACAACTTGG - Intronic
1100051209 12:90450107-90450129 GCCATCTGCACATCCTCTCTTGG + Intergenic
1103627123 12:122227646-122227668 GCCGCCTGCTCAGCCCATCTGGG - Intronic
1111400618 13:87729537-87729559 TCCCTTTGCTCAGCCCCTCTGGG - Intergenic
1111453835 13:88453806-88453828 GCCTTTTGCACCCTCCATCTTGG + Intergenic
1116218572 14:42052780-42052802 GTCTTCTGCACAGCCCATATGGG - Intergenic
1119450821 14:74708384-74708406 ACTGTTTGCACAGCCCACCTGGG + Intronic
1121482423 14:94289418-94289440 GCTATGTGCCAAGCCCATCTGGG + Intronic
1121539560 14:94714870-94714892 GCCATGTGCTCAGCTCATTTTGG + Intergenic
1122937809 14:104967968-104967990 GCCACTTGCAGAGCCTGTCTGGG - Intronic
1125167255 15:36721924-36721946 GCCATTTGGACATCACAGCTGGG + Intronic
1125530680 15:40411515-40411537 GCTATTTGCTCAAGCCATCTTGG - Intronic
1129004592 15:72361821-72361843 GCCATTTTCCCAGCCCCACTGGG + Intronic
1132562233 16:601353-601375 GCCTTCTGCCCAGCCCACCTAGG - Intronic
1133599920 16:7329195-7329217 GCCATCTGCTCTGCCCATCACGG - Intronic
1136572936 16:31107624-31107646 GCCATATCCTCAGACCATCTGGG + Intronic
1138681051 16:58683966-58683988 GCCTCTGGCACAGCCCATCAGGG - Exonic
1139601704 16:67991295-67991317 CCCATTTGCAGGGCCCATTTTGG - Intronic
1144745116 17:17608954-17608976 GCCATCTCCAGAGCCCACCTAGG - Intergenic
1146101929 17:29991251-29991273 GCCATTTGCTGAGACCAGCTCGG + Intronic
1146926709 17:36750577-36750599 GCAGTTTGCACAGCGCATGTGGG - Intergenic
1150510787 17:65750815-65750837 GCCAGCTGCACCGCCCTTCTGGG + Intronic
1152463140 17:80451645-80451667 GCCACCTTCCCAGCCCATCTGGG + Intergenic
1156269009 18:35513888-35513910 TCCATTTTCACAGCCCCCCTGGG + Intergenic
1158612578 18:58955627-58955649 GCCATGTTCACAGGCCATTTGGG - Intronic
1161367621 19:3889825-3889847 GCCATTTGCACAGCCCATCTCGG - Intronic
1164183189 19:22837741-22837763 GACATGTGCACAGCCCTTCCAGG + Intergenic
1164498190 19:28788582-28788604 GCCATCTGCACAGCTTCTCTGGG + Intergenic
1164674480 19:30092270-30092292 GCCATTTGAACAGCCCTCATTGG + Intergenic
1165078115 19:33291886-33291908 TCCATTTGCCCAACCCAGCTCGG - Intergenic
1167863792 19:52307497-52307519 GCCACTTGCTCAGACCAGCTCGG + Intronic
1168091064 19:54084662-54084684 GCCATTTGCAAGTGCCATCTTGG - Intergenic
925147458 2:1590790-1590812 ACCATCTGCACAGCCCTGCTTGG - Intergenic
929536375 2:42786917-42786939 GCCACTTCCACAGCGCATCCTGG + Intronic
929571058 2:43023320-43023342 GCCACTGGCACAACCCATTTCGG - Intergenic
948171988 2:235911308-235911330 GCCCTTTACACAGCCCTCCTGGG - Intronic
948457724 2:238114591-238114613 GCCACTGGCTCAGCCCTTCTGGG + Intronic
1169130213 20:3162917-3162939 ACCCTCTGCACAGCCCTTCTGGG - Exonic
1171159054 20:22905087-22905109 GCCATTTGCCCAGCCCTTGCTGG + Intergenic
1175919918 20:62446067-62446089 GCCATTTGCTCAGCTCAGCGTGG + Intergenic
1178173007 21:30062932-30062954 GCAAATTGCTCAGTCCATCTGGG - Intergenic
1179536385 21:42055461-42055483 GCCTACTTCACAGCCCATCTGGG + Intergenic
1179560895 21:42215514-42215536 TCTATTAGCACAGCCCATGTTGG - Intronic
1180030047 21:45200633-45200655 ACCTTCTGCAGAGCCCATCTTGG - Intronic
1181093108 22:20487698-20487720 GCCCTTTCCACAGCCCCCCTTGG - Intronic
1181101152 22:20540162-20540184 GCCCTTTCCACAGCCCCCCTTGG - Intronic
1181703511 22:24634128-24634150 CCCATTTGCACATCCCAGGTGGG + Intergenic
1183903275 22:41021948-41021970 GCCATTTCCGCAGCCCAGCTCGG + Intergenic
953130490 3:40133328-40133350 TCCATTTGCAGAGATCATCTTGG + Intronic
954862611 3:53703274-53703296 GCCATATGCTTAGCCCATCAGGG + Intronic
957475641 3:80719804-80719826 GCCATTCTCACAGTCCATCTGGG - Intergenic
959839779 3:110960748-110960770 GGCATTTGGACACCACATCTAGG - Intergenic
961369310 3:126419843-126419865 GCCACTGGCAGAGCCCACCTGGG - Intronic
961616009 3:128181646-128181668 TCCTTATGCACAGCCCACCTGGG + Intronic
961775270 3:129279469-129279491 GGCATTTGCAGAGCTCCTCTCGG + Intronic
962939273 3:140110865-140110887 GCCAATTGCAAGTCCCATCTTGG - Intronic
966978262 3:185105697-185105719 GCCATTTGCCGAGACCAGCTCGG - Intronic
969510820 4:7616917-7616939 GACATTTGCACAGCCCCACAAGG + Intronic
973547723 4:51998781-51998803 GCCATTTGCCGAGCCCTGCTGGG + Intronic
973652049 4:53006159-53006181 GGAATTTTCAGAGCCCATCTTGG - Intronic
974372403 4:61034468-61034490 GCCATTTGCAAAAGCCACCTAGG + Intergenic
977450004 4:97183467-97183489 ACCATTTGTATAGACCATCTTGG - Intergenic
984847365 4:184119452-184119474 GTCATATGCTCAGCACATCTGGG - Intronic
985500670 5:242636-242658 GCCATTTGCCGAGACCAGCTCGG - Intronic
990652302 5:57915417-57915439 GCCATTTGCACATCACCTCTGGG + Intergenic
994799425 5:104352612-104352634 GCCCTTTGCAGAGGCCAACTGGG + Intergenic
999721402 5:154401678-154401700 GCCCTGTGCACATCCCCTCTCGG + Intronic
1002499879 5:179641340-179641362 GCCAGTTGCACAGCCCCTGGAGG + Intergenic
1002502091 5:179653421-179653443 GCCAGTTGCACAGCCCCTGGAGG - Intergenic
1004615869 6:17288278-17288300 GCCACATGGACAGCCCTTCTTGG - Intronic
1004741162 6:18462700-18462722 GCCTTTTGAACAGCCCTGCTTGG + Intronic
1006054717 6:31375115-31375137 GCCTCCTGCAGAGCCCATCTAGG - Intergenic
1006935647 6:37715673-37715695 GCCATTTGGACAGGAAATCTGGG + Intergenic
1006945826 6:37783939-37783961 GCCATTAGCACAGCCCGGCCCGG - Intergenic
1007373363 6:41441390-41441412 GCCCTTCTCACAGCCCCTCTTGG - Intergenic
1012593803 6:101016862-101016884 GCCATTTCCAGAGTCCCTCTGGG + Intergenic
1015993387 6:138971894-138971916 GCCATTTGCTTAGCCCTGCTTGG - Intronic
1017360172 6:153559456-153559478 GCCCTTTTCACAGTGCATCTTGG + Intergenic
1018294420 6:162330325-162330347 CCCCTTTCCACAGCCCATTTGGG - Intronic
1024351874 7:48374723-48374745 CACATTTGCACACCCTATCTTGG - Intronic
1030264948 7:107610744-107610766 ACCACTTGTACAGCCTATCTAGG - Intronic
1031026369 7:116684655-116684677 GCCATGTGCTCAGCCACTCTGGG - Intronic
1039966889 8:42290291-42290313 GCCAGGTGCACAGCCTGTCTGGG + Intronic
1041249267 8:55918828-55918850 CACTTTTGCACAGCCCATCATGG - Intronic
1041433414 8:57809928-57809950 GCCATTTGCATAACAAATCTTGG + Intergenic
1042664655 8:71192198-71192220 GCCAATTGGACAGCCCTGCTTGG + Intergenic
1042714087 8:71753021-71753043 GCCTTTTGCACAGCCCAAGTGGG + Intergenic
1045385445 8:101667527-101667549 GCCCATTGCAGAGTCCATCTTGG - Exonic
1050483918 9:6114383-6114405 GCCACTGTCACAGCCCAGCTGGG + Intergenic
1052861062 9:33438159-33438181 GCCATCTCCACAGCCCACTTTGG - Intergenic
1053803801 9:41780334-41780356 CCCATTTGCACAGCCCTGCCTGG - Intergenic
1054141468 9:61534786-61534808 CCCATTTGCACAGCCCTGCCTGG + Intergenic
1054192101 9:61991729-61991751 CCCATTTGCACAGCCCTGCCTGG - Intergenic
1054461169 9:65465502-65465524 CCCATTTGCACAGCCCTGCCTGG + Intergenic
1054646278 9:67596061-67596083 CCCATTTGCACAGCCCTGCCTGG + Intergenic
1059799363 9:117734537-117734559 GGCATATGCACAGGCCATCCAGG + Intergenic
1062641888 9:137522984-137523006 GCACTTTGCACAGCCCAGCCTGG - Intronic
1186744987 X:12558183-12558205 ACCATTTGCACATCCCTTCATGG + Intronic
1189384081 X:40522299-40522321 GCCATTGCCACTGCCAATCTGGG - Intergenic
1197164623 X:123363119-123363141 GCCATTTGTACTGTTCATCTGGG - Intronic